More Fields
Strain Species Genotype
CGC147 C. elegans mir-1818(umn54[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])I. Show Description
mir-1818 pre-miRNA deletion allele in which mir-1818 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC148 C. elegans mir-47(umn55[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])I. Show Description
mir-47 pre-miRNA deletion allele in which mir-47 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC149 C. elegans mir-81(umn56[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])I. Show Description
mir-81 pre-miRNA deletion allele in which mir-81 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC150 C. elegans mir-1829.3&F39B1.3(umn57[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])X. Show Description
mir-1829.3 pre-miRNA & F39B1.3 deletion allele in which mir-1829.3 pre-miRNA & F39B1.3 was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC151 C. elegans mir-1829.2(umn58[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-1829.2 pre-miRNA deletion allele in which mir-1829.2 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC154 C. elegans mir-4812(umn61[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-4812 pre-miRNA deletion allele in which mir-1824 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC89 C. elegans tmIn58 [umnIs68] I; lig-4(tm750) III. Show Description
umnIs68 [myo-2p::GFP + NeoR, I:6284001(intergenic)] I. Break points: In(gsp-3 sre-23) I. Covered region (Mb) 3.5 (4.7..8.3). Derived by insertion of myo-2p::GFP transgene into parental strain FX19704 using CRISPR/Cas9.
CL2070 C. elegans dvIs70. Show Description
dvIs70 [hsp-16.2p::GFP + rol-6(su1006)]. Roller. Integrated array containg pCL25 (hsp-16-2 promoter/GFP transcriptional fusion) and pRF4. Shows robust induction of GFP expression after heat induction. Not known where dvIs70 is integrated.
CL2659 C. elegans smg-1(cc546) I; dvIs770. Show Description
dvIs770 [myo-3::Abeta 1-42 wt::3' UTR(long) + mtl-2::GFP]. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in 18-24 hr if induced as L3 larvae. NOTE: dvIs770 was originally described as dvIs70 in Fonte et al, 2011. The name of this array was changed to dvIs770 to avoid confusion with dvIs70 [hsp-16.2p::GFP + rol-6(su1006)] carried in strain CL2070. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CT20 C. elegans zaIs5. Show Description
zaIs5 [alg-1p::GFP::alg-1 + rol-6(su1006)]. Some GFP+ animals do not roll. GFP::ALG-1 expression throughout development, detectable as punctate cytoplasmic granules. Maintain by picking rollers. Reference: Chan SP, Slack FJ. Dev Biol. 2009 Oct 1;334(1):152-60.
CU7905 C. elegans smIs350 IV; unc-76(e911) V. Show Description
smIs350 [hsp-16::mCherry-NLS + tra-2::FLAG(3x) + unc-76(+)] IV. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press.
CYA1 C. elegans rexIs1. Show Description
rexIs1 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of Halo protein with TEV recognition site for the tobacco etch virus protease and human Keap1 protein (an established RES sensor). No phenotypic change upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.
CYA2 C. elegans rexIs2. Show Description
rexIs2 [hsp-16p::tom70::mCherry::halo + mec-7p::mRFP]. Array is prone to silencing; pick RFP animals to maintain array. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of mCherry with tom70 (outer mitochondrial membrane targeting sequence from yeast) and Halo protein. Global red fluorescence upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.
DA1877 Comamonas sp. Comamonas sp. Show Description
Bacteria. Comamonas sp., a bacterium on which C. elegans grows particularly well. Str-R. DA1877 is derived from a bacterium isolated from soil in the Dallas area by Boris Shtonda in 2002. That strain was called H39 in Avery, L, Shtonda, BB (2003), "Food transport in the C elegans pharynx", J Exp Biol 206: 2441-2457. It was identified as genus Comamonas by 16S rDNA sequencing, as described in the paper. L. Avery isolated a spontaneous streptomycin-resistant variant by selecting for growth in LB broth + 200 ug/ml streptomycin sulfate. This strain, when spread on NGMSR plates, gave rise to faster-growing papillae; one of these was streaked out to get DA1877. Biosafety Level: BSL-1.
DAW1 Panagrolaimus sp. Show Description
Antarctic nematode isolated from Ross Island, Antarctica in 1988. Panagrolaimus sp. DAW1 formerly known as Panagrolaimus davidi or P. davidi CB1. Survives freezing at -80 °C, including extensive intracellular freezing. Reference: Raymond MR, Wharton DA, Marshall CJ (2014) Antarc Sci 26:15-22.
DC1 C. elegans bah-1(br1) I. Show Description
Bah (biofilm absent on head - resistant to attachment of Yersinia sp. biofilms). Fragile cuticle (mild): increased sensitivity to alkaline-hypochlorite.
DC7 C. elegans bah-2(br7) IV. Show Description
Bah (biofilm absent on head - resistant to attachment of Yersinia sp. biofilms). Fragile cuticle (mild): increased sensitivity to alkaline-hypochlorite.
DC9 C. elegans bah-3(br9) I. Show Description
Bah (biofilm absent on head - resistant to attachment of Yersinia sp. biofilms). Cld: constitutive larval display of epitope recognized by monoclonal antibody M37.
DCR1673 C. elegans olaEx987. Show Description
olaEx987 [ttx-3p::mCherry::rab-3 + hlh-17p::CD4::GFP1-10 + ttx-3p::CD4::GFP11 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx987 labels AIY presynaptic sites with mCherry, and AIY and CEPsh contact with GFP. oleEx987 contains GRASP (GFP Reconstitution Across Synaptic Partners) constructs using two GFP fragments, GFP1-10 and GFP11, that can reconstitute a functional GFP molecule only when they are in close proximity. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DCR2188 C. elegans olaEx1316. Show Description
olaEx1316 [ttx-3p::CD4::GFP11 + glr-3p::CD4::GFP1-10 + ttx-3p::mCherry::rab-3 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1316 labels AIY presynaptic sites with mCherry, and AIY and RIA contact with GFP. oleEx1316 contains GRASP (GFP Reconstitution Across Synaptic Partners) constructs using two GFP fragments, GFP1-10 and GFP11, that can reconstitute a functional GFP molecule only when they are in close proximity. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DF5033 Oscheius dolichura Show Description
WT strain. Oscheius sp. See WBG 12(5) 14. Male/Female strain. Collected by a Belgian expedition to the Galapagos archipelago. From Gaetan Borgonie, Gent University, Belgium.
DF5070 C. sp. 2 Show Description
NOTE: To freeze this strain, heat shock at 37°C for 1 hr and add CaCl2 2mM in freezing solution.
DF5152 C. sp. 30 Show Description
Isofemale line. Isolated from a rotten lemon collected at Chan Chich Lodge in the town of Gallon Jug, Orange Walk, Belize (17.56399°N, 89.046282°W) on 11/15/12.
DF5173 C. sp. 8 Show Description
Male-female strain. 20x inbred line derived from TMG13. Heat shock 2.5-3.0 hrs at 30C immediately prior to freezing.
DLW14 C. elegans unc-5(lib1[myo-3p::GFP(-) + unc-119(+) + myo-2p::GFP(Mos1)]) IV; krIs14 V. Show Description
krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021.
DM1602 C. elegans hsp-1(ra807) IV; unc-23(e25) V. Show Description
Superficially wild-type. Temperature-sensistive. Maintain at 15C. hsp-1(ra807) is a missense allele that replaces the conserved Ala379 residue to a Val residue in the ATPase domain of the HSP-1 protein and fully suppresses the bent-head phenotype of unc-23(e25). Animals are sterile or arrest development as larvae at when grown at 20-25C. Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.
DM2407 C. elegans hsp-1(ra807) IV; dpy-11(e224) V. Show Description
Dpy. hsp-1(ra807) is a missense allele that replaces the conserved Ala379 residue to a Val residue in the ATPase domain of the HSP-1 protein and fully suppresses the bent-head phenotype of unc-23(e25). Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.
DR848 C. elegans daf-8(e1393) unc-29(e1072) I. Show Description
Unc-weak kinker, doesn't back well. Temperature sensitive dauer constitutive. Maintain at 15C. Makes high percentage of dauers at 25C. tsp for dauer formation is L1 molt. Type C Egl. Active. Resistant to 1 mM levamisole. Sensitive to hypoosmotic shock.
DWF1105 Acrobeloides sp. Show Description
Isolated in Arizona desert. Identification by E. Mae Noffsinger.
DWF1106 Acrobeloides sp. Show Description
Isolated in Arizona desert. Identification by E. Mae Noffsinger as Acrobeloides obliquus.
DWF1108 Acrobeloides sp. Show Description
Originally from ecological study at University of GA. Identification by E. Mae Noffsinger.
DWF1301 Cephalobus sp. Show Description
Isolated in Fort Collins, CO. Species identification done by Lynn Carta.
DWF1501 Dolichorhabditis sp. Show Description
Isolated in Brazil.
DWF1604 Operculrhabditis sp. Show Description
Originally from UCR collection. Identification by E. Mae Noffsinger.
DWF1701 Zeldia sp. Show Description
Isolated in Fort Collins, CO. Species identification done by Lynn Carta.
EG1642 C. elegans lin-15B&lin-15A(n765) X; oxEx166. Show Description
oxEx166 [HSP::MosTRANSPOSASE + CC::GFP + lin-15(+)]. Should be grown at 25C. Maintain by picking non-Muv. Animals carrying the array should be GFP+.
EG2762 C. elegans oxEx166. Show Description
oxEx166 [HSP::MosTransposase + coelomocyte::GFP + lin-15(+)]. Should be grown at 25C.
EG4788 C. portoensis Show Description
Male-female strain. Maintain by mating. Caenorhabditis sp. 6 wild isolate. Isolated by Michael Ailion and Ana-Joao Rodrigues from a rotting apple collected from the home of Anabela Fernandes in Amares, Portugal (address: Dr. Adolofo Vilela, no. 29, 4720-019 Amares, Portugal). Coordinates: 41 degrees, 37', 43.577 " N; 8 degrees, 20', 51.421 " W. Apple collected March 28, 2007. The apple produced a number of growing animals in different stages, including adults of both sexes. Male/Female Caenorhabditis species. 18S RNA sequence places it closest to PS1010 C. sp. 3.
EG5268 C. nigoni Show Description
Caenorhabditis sp. 9 Male-female strain. Isolated from a sample collected by Joel Ehrenkranz on May 20, 2008, around 11 AM in Shinkolobwe, Katanga Province, Democratic Republic of the Congo (~11°S, 26°E). The sample was collected from worked soil which contained organic material around the foundation of a wattle hut. This time of year was the dry season in Katanga Province, so daytime temperatures were in the high 70s and nighttime temperatures in the low 50s. The specimen was placed in a ziplock bag with a slice of apple for transport to Susan Mango's lab at the Huntsman Cancer Institute, Salt Lake City, Utah. From the date of collection until the specimen reached the lab was approximately 2 weeks.
EG5716 C. imperialis Show Description
Caenorhabditis sp. 14 Male-female strain. Isolated from a rotten horse chestnut (Tahitian chestnut?) collected by David Ailion on the island of Moorea (17.53 S, 149.83 W) on July 24, 2009.
EG5897 C. elegans oxSi120 II; unc-119(ed3) III. Show Description
oxSi120 [peel-1p::tagRFP::msp-142 3'UTR + unc-119(+)]. Reference: Batchelder EL, et al. Proc Natl Acad Sci U S A. 2011 Jul 12;108(28):11429-34.
EG5942 C. imperialis Show Description
Caenorhabditis sp. 14 Male-female strain. Made by inbreeding EG5716 for 30 generations by picking a single L4 female and male at each generation.
EG6142 C. yunquensis Show Description
Caenorhabditis sp. 19 Male-female strain. Isolated from a rotten fruit/seed of Ausubo (Manilkara dentata) collected by Susan Dalton in El Yunque, Puerto Rico, near El Verde (~18.3°N, 65.8°W), around March 28, 2010.
EG7566 C. elegans unc-119(ed3) III; oxTi211 V. Show Description
oxTi211 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see for exact insertion site.
EG7916 C. elegans unc-119(ed3) III; oxTi208 IV. Show Description
oxTi208 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see for exact insertion site.
EG7952 C. elegans unc-119(ed3) III; oxTi207 V. Show Description
oxTi207 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see for exact insertion site.
EG9876 C. elegans unc-119(ox819 oxTi1126) III. Show Description
oxTi1126 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Knock-in into previously modified unc-119(ox819) endogenous locus. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Lower activity than other Cas9 strains, but useful because Cas9, Cre, and unc-119 are in a single unit. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi:
EG9881 C. elegans unc-119(ox819) F53A2.9(oxTi1127) III. Show Description
oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Integrated Cas9 transgene linked to unc-119(ox819). Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi:
EG9882 C. elegans F53A2.9(oxTi1127) III. Show Description
oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi:
EG9885 C. elegans W01A8.6(oxTi1120) I; unc-119(ox819) III. Show Description
oxTi1120 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272] I. Inserted into W01A8.6. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: