mir-1818 pre-miRNA deletion allele in which mir-1818 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-47 pre-miRNA deletion allele in which mir-47 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-81 pre-miRNA deletion allele in which mir-81 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-1829.3 pre-miRNA & F39B1.3 deletion allele in which mir-1829.3 pre-miRNA & F39B1.3 was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-1829.2 pre-miRNA deletion allele in which mir-1829.2 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-4812 pre-miRNA deletion allele in which mir-1824 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

umnIs68 [myo-2p::GFP + NeoR, I:6284001(intergenic)] I. Break points: In(gsp-3 sre-23) I. Covered region (Mb) 3.5 (4.7..8.3). Derived by insertion of myo-2p::GFP transgene into parental strain FX19704 using CRISPR/Cas9.

dvIs70 [hsp-16.2p::GFP + rol-6(su1006)]. Roller. Integrated array containg pCL25 (hsp-16-2 promoter/GFP transcriptional fusion) and pRF4. Shows robust induction of GFP expression after heat induction. Not known where dvIs70 is integrated.

dvIs770 [myo-3::Abeta 1-42 wt::3' UTR(long) + mtl-2::GFP]. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in 18-24 hr if induced as L3 larvae. NOTE: dvIs770 was originally described as dvIs70 in Fonte et al, 2011. The name of this array was changed to dvIs770 to avoid confusion with dvIs70 [hsp-16.2p::GFP + rol-6(su1006)] carried in strain CL2070. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

zaIs5 [alg-1p::GFP::alg-1 + rol-6(su1006)]. Some GFP+ animals do not roll. GFP::ALG-1 expression throughout development, detectable as punctate cytoplasmic granules. Maintain by picking rollers. Reference: Chan SP, Slack FJ. Dev Biol. 2009 Oct 1;334(1):152-60.

smIs350 [hsp-16::mCherry-NLS + tra-2::FLAG(3x) + unc-76(+)] IV. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press.

rexIs1 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of Halo protein with TEV recognition site for the tobacco etch virus protease and human Keap1 protein (an established RES sensor). No phenotypic change upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.

rexEx10 [hsp-16p::his-6::Halo + mec-7p::mRFP]. Pick RFP+ to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces the expression of Halo protein.

dvIs19 [gst-4p::GFP::NLS] III. rexEx11 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of Halo::TEV::Keap1 protein. Oxidative stress induces expression of GFP. Superficially wild-type.

rexIs2 [hsp-16p::tom70::mCherry::halo + mec-7p::mRFP]. Array is prone to silencing; pick RFP animals to maintain array. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of mCherry with tom70 (outer mitochondrial membrane targeting sequence from yeast) and Halo protein. Global red fluorescence upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.

dvIs19 [gst-4p::GFP::NLS] III. rexEx12 [hsp-16p::tom70::mCherry::halo + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of mCherry::Halo protein. Oxidative stress induces expression of GFP.

dvIs19 [gst-4p::GFP::NLS] III. rexEx13 [hsp-16p::HA::wdr-23::halo + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of HA::WDR23::Halo protein. Oxidative stress induces expression of GFP.

Bacteria. Comamonas sp., a bacterium on which C. elegans grows particularly well. Str-R. DA1877 is derived from a bacterium isolated from soil in the Dallas area by Boris Shtonda in 2002. That strain was called H39 in Avery, L, Shtonda, BB (2003), "Food transport in the C elegans pharynx", J Exp Biol 206: 2441-2457. It was identified as genus Comamonas by 16S rDNA sequencing, as described in the paper. L. Avery isolated a spontaneous streptomycin-resistant variant by selecting for growth in LB broth + 200 ug/ml streptomycin sulfate. This strain, when spread on NGMSR plates, gave rise to faster-growing papillae; one of these was streaked out to get DA1877. Biosafety Level: BSL-1.

Antarctic nematode isolated from Ross Island, Antarctica in 1988. Panagrolaimus sp. DAW1 formerly known as Panagrolaimus davidi or P. davidi CB1. Survives freezing at -80 °C, including extensive intracellular freezing. Reference: Raymond MR, Wharton DA, Marshall CJ (2014) Antarc Sci 26:15-22.

Bah (biofilm absent on head - resistant to attachment of Yersinia sp. biofilms). Fragile cuticle (mild): increased sensitivity to alkaline-hypochlorite.

Bah (biofilm absent on head - resistant to attachment of Yersinia sp. biofilms). Fragile cuticle (mild): increased sensitivity to alkaline-hypochlorite.

Bah (biofilm absent on head - resistant to attachment of Yersinia sp. biofilms). Cld: constitutive larval display of epitope recognized by monoclonal antibody M37.

olaEx987 [ttx-3p::mCherry::rab-3 + hlh-17p::CD4::GFP1-10 + ttx-3p::CD4::GFP11 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx987 labels AIY presynaptic sites with mCherry, and AIY and CEPsh contact with GFP. oleEx987 contains GRASP (GFP Reconstitution Across Synaptic Partners) constructs using two GFP fragments, GFP1-10 and GFP11, that can reconstitute a functional GFP molecule only when they are in close proximity. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

olaEx1316 [ttx-3p::CD4::GFP11 + glr-3p::CD4::GFP1-10 + ttx-3p::mCherry::rab-3 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1316 labels AIY presynaptic sites with mCherry, and AIY and RIA contact with GFP. oleEx1316 contains GRASP (GFP Reconstitution Across Synaptic Partners) constructs using two GFP fragments, GFP1-10 and GFP11, that can reconstitute a functional GFP molecule only when they are in close proximity. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

WT strain. Oscheius sp. See WBG 12(5) 14. Male/Female strain. Collected by a Belgian expedition to the Galapagos archipelago. From Gaetan Borgonie, Gent University, Belgium.

NOTE: To freeze this strain, heat shock at 37°C for 1 hr and add CaCl2 2mM in freezing solution.

Isofemale line. Isolated from a rotten lemon collected at Chan Chich Lodge in the town of Gallon Jug, Orange Walk, Belize (17.56399°N, 89.046282°W) on 11/15/12.

Male-female strain. 20x inbred line derived from TMG13. Heat shock 2.5-3.0 hrs at 30C immediately prior to freezing.

krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021. https://doi.org/10.1016/j.cub.2021.03.008

Superficially wild-type. Temperature-sensistive. Maintain at 15C. hsp-1(ra807) is a missense allele that replaces the conserved Ala379 residue to a Val residue in the ATPase domain of the HSP-1 protein and fully suppresses the bent-head phenotype of unc-23(e25). Animals are sterile or arrest development as larvae at when grown at 20-25C. Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.

Dpy. hsp-1(ra807) is a missense allele that replaces the conserved Ala379 residue to a Val residue in the ATPase domain of the HSP-1 protein and fully suppresses the bent-head phenotype of unc-23(e25). Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.

Unc-weak kinker, doesn't back well. Temperature sensitive dauer constitutive. Maintain at 15C. Makes high percentage of dauers at 25C. tsp for dauer formation is L1 molt. Type C Egl. Active. Resistant to 1 mM levamisole. Sensitive to hypoosmotic shock.

Isolated in Arizona desert. Identification by E. Mae Noffsinger.

Isolated in Arizona desert. Identification by E. Mae Noffsinger as Acrobeloides obliquus.

Originally from ecological study at University of GA. Identification by E. Mae Noffsinger.

Isolated in Fort Collins, CO. Species identification done by Lynn Carta.

Isolated in Brazil.

Originally from UCR collection. Identification by E. Mae Noffsinger.

Isolated in Fort Collins, CO. Species identification done by Lynn Carta.

oxEx166 [HSP::MosTRANSPOSASE + CC::GFP + lin-15(+)]. Should be grown at 25C. Maintain by picking non-Muv. Animals carrying the array should be GFP+.

oxEx166 [HSP::MosTransposase + coelomocyte::GFP + lin-15(+)]. Should be grown at 25C.

Male-female strain. Maintain by mating. Caenorhabditis sp. 6 wild isolate. Isolated by Michael Ailion and Ana-Joao Rodrigues from a rotting apple collected from the home of Anabela Fernandes in Amares, Portugal (address: Dr. Adolofo Vilela, no. 29, 4720-019 Amares, Portugal). Coordinates: 41 degrees, 37', 43.577 " N; 8 degrees, 20', 51.421 " W. Apple collected March 28, 2007. The apple produced a number of growing animals in different stages, including adults of both sexes. Male/Female Caenorhabditis species. 18S RNA sequence places it closest to PS1010 C. sp. 3.

Caenorhabditis sp. 9 Male-female strain. Isolated from a sample collected by Joel Ehrenkranz on May 20, 2008, around 11 AM in Shinkolobwe, Katanga Province, Democratic Republic of the Congo (~11°S, 26°E). The sample was collected from worked soil which contained organic material around the foundation of a wattle hut. This time of year was the dry season in Katanga Province, so daytime temperatures were in the high 70s and nighttime temperatures in the low 50s. The specimen was placed in a ziplock bag with a slice of apple for transport to Susan Mango's lab at the Huntsman Cancer Institute, Salt Lake City, Utah. From the date of collection until the specimen reached the lab was approximately 2 weeks.

Caenorhabditis sp. 14 Male-female strain. Isolated from a rotten horse chestnut (Tahitian chestnut?) collected by David Ailion on the island of Moorea (17.53 S, 149.83 W) on July 24, 2009.

oxSi120 [peel-1p::tagRFP::msp-142 3'UTR + unc-119(+)]. Reference: Batchelder EL, et al. Proc Natl Acad Sci U S A. 2011 Jul 12;108(28):11429-34.

Caenorhabditis sp. 14 Male-female strain. Made by inbreeding EG5716 for 30 generations by picking a single L4 female and male at each generation.

Caenorhabditis sp. 19 Male-female strain. Isolated from a rotten fruit/seed of Ausubo (Manilkara dentata) collected by Susan Dalton in El Yunque, Puerto Rico, near El Verde (~18.3°N, 65.8°W), around March 28, 2010.

oxTi211 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.

oxTi208 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.

oxTi207 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.