More Fields
Strain Species Genotype
PX658 C. elegans fxSi1 I; fxSi4 II; fxSi6 III; spe-44(fx123[spe-44::degron]) IV; fog-2(fx111) V. Show Description
fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. fxSi6 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, III: 10158855] III. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. fxSi4 was originally inserted in a CB4845 background, but has been sufficiently backcrossed so that PX658 is >98.5% JU2526 genetic background. Reference: Kasimatis, KR. et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605
QG122 C. kamaaina Show Description
Caenorhabditis sp. 15 Isolated in Kaui (Hawaii) from unidentified wild rotten fruit.
QG3050 C. sp. 57 Caenorhabditis sp. 57 wild isolate. Show Description
Male-female strain. Wild type isofemale line of Caenorhabditis sp. 57. Isolated from a rotten fig collected from the forest floor, Barro Colorado Island, Panama, 23 August 2018. Coordinates 9°9.787, 79°50.232.
QG555 C. sp. 24 Show Description
Isolated by Annalise Paaby from an orange peel collected beneath a fig tree on State Street, Santa Barbara, CA (34.421629, -119.702021) in July 2010.
QG702 C. panamensis Caenorhabditis panamensis wild isolate. Show Description
Isofemale line. Isolated by M. Rockman from a rotting palm fruit (?) on the Snyder-Molino trail on Barro Colorado Island, Panama (9°09.656' N, 79°50.490'W) on 4/24/12. Previously known as Caenorhabditis sp. 28.
QG704 C. becei Caenorhabditis becei wild isolate. Show Description
Isofemale line. Isolated by M. Rockman from a rotten Gustavia superba flower on Barro Colorado Island, Panama (9°09.222'N, 79°49.564'W) on 4/25/12. Previously known as Caenorhabditis sp. 29.
QV65 C. elegans vsIs33 V; gpIs1. Show Description
vsIs33 [dop-3::RFP] V. gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Reference: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166.
QX1182 C. sp. 8 Show Description
Male-female strain. Isolated by M. Rockman from rotting tomatoes in New Jersey, USA, July 2007. NOTE: To freeze this strain, heat shock at 37°C for 1 hr and add CaCl2 2mM in freezing solution.
QX2263 C. sp. 27 Caenorhabditis sp. 27 wild isolate. Show Description
Male-female strain. Maintain by mating. Isolated from garden soil in Buenos Aires, Argentina on 3/2/2012.
RB1098 C. elegans hsp-12.6(ok1077) IV. Show Description
F38E11.2 Homozygous. Outer Left Sequence: GTGACGATTCGAGAGCAACA. Outer Right Sequence: CGTGCGAAGATTGAACAGAA. Inner Left Sequence: TTCGAAGCTCAATGAACGAA. Inner Right Sequence: AGCCCAAGATGACAATGGAC. Inner Primer PCR Length: 2303. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1104 C. elegans hsp-3(ok1083) X. Show Description
C15H9.6 Homozygous. Outer Left Sequence: GGGGTAGGAGAGCCATTTTC. Outer Right Sequence: ACTTGGCCTTTTCCGATTTT. Inner Left Sequence: CGATCGTTTAGAGCTCGTCC. Inner Right Sequence: CCTGCCGTTTCCATAACAGT. Inner Primer PCR Length: 2947. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1450 C. elegans csp-3(ok1653) I. Show Description
Y47H9C.6. Homozygous. Outer Left Sequence: GGAATCGGAATTGGAACTCA. Outer Right Sequence: CTTCATCGCCACTCACTCAA. Inner Left Sequence: TAATTTCAGCCAATTTGCCC. Inner Right Sequence: CAAACGCCACTGGATTCTCT. Inner Primer PCR Length: 2153 bp. Deletion Size: 1249 bp. Deletion left flank: TCTTTTGAGAGAGCCAATAAGTTTTATTTT. Deletion right flank: TCCGCTTGCGACGACGAGGTTTGGTGTGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1451 C. elegans rsp-5(ok324) II. Show Description
T28D9.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1485 C. elegans csp-2(ok1742) IV. Show Description
Y73B6BL.7. Homozygous. Outer Left Sequence: GCGACGAAGAATGTTCAGGT. Outer Right Sequence: TTATGTCTTGGTGCGTCTCG. Inner Left Sequence: AGATTGATCGGCTTTGCACT. Inner Right Sequence: AGATGCCGACGTCAATTTTC. Inner Primer PCR Length: 3112 bp. Deletion Size: 1722 bp. Deletion left flank: TTTCCAAATTCATAGGAAAAATACTCTGAA. Deletion right flank: TTGCAAATTCTTGAAAGTAAAGTCAACTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1823 C. elegans gst-4&msp-38(ok2358) IV. Show Description
K08F4.7, K08F4.8. Homozygous. Outer Left Sequence: ATGCTGGGTGAAACTAACGG. Outer Right Sequence: AAAGATCTGGGGCAGTGATG. Inner Left Sequence: TCCTCGAACATCGAAACACA. Inner Right Sequence: AAGGTGATCAACTCATCGGC. Inner Primer PCR Length: 2170 bp. Deletion Size: 1548 bp. Deletion left flank: CAAACCTTGGGCAAGAATTTCCAGAGATTG. Deletion right flank: GAATTGTTTGGCAGCGCCATCCGGGGTGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2035 C. elegans asp-4(ok2693) X. Show Description
R12H7.2. Homozygous. Outer Left Sequence: ATCTGTTGCTTAGTGGCGCT. Outer Right Sequence: GTGAACTGATGCTGACCGAA. Inner Left Sequence: CCATGGATTCCTCACTTTCG. Inner Right Sequence: TGCTTCATCACCGTTACGAC. Inner Primer PCR Length: 1185 bp. Deletion Size: 613 bp. Deletion left flank: AGACAGAACGGAATGGTCGTGGAGCTGGAT. Deletion right flank: GAGAAAAGATTCGATGGGACCTTCTTCTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2582 C. elegans tsp-1(ok3594) III. Show Description
C02F5.8 Homozygous. Outer Left Sequence: ccagcattgcaagactcaaa. Outer Right Sequence: aaggactacgccagcttgaa. Inner Left Sequence: ccttgacgtcattccgatct. Inner Right Sequence: tcaaaagtgttagcattaacgaaa. Inner Primer PCR Length: 1252. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2600 C. elegans hsp-12.1(ok3622) I. Show Description
T22A3.2 Homozygous. Outer Left Sequence: ttgaaaatgtttcttcgggg. Outer Right Sequence: aattacaactgactcggcgg. Inner Left Sequence: tgccagaaacttccagttca. Inner Right Sequence: gccccttcagcataacgat. Inner Primer PCR Length: 1319. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2612 C. elegans hsp-12.2(ok3638) III. Show Description
C14B9.1 Homozygous. Outer Left Sequence: tttcaggtccacaacaccaa. Outer Right Sequence: aaaatcatccctcgatgtgc. Inner Left Sequence: agttcgaggtcggacttgac. Inner Right Sequence: cattattcgtgcgttgatgc. Inner Primer PCR Length: 1096. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB643 C. elegans msp-38(ok346) IV. Show Description
K08F4.8. Homozygous. Outer Left Sequence: atgctgggtgaaactaacgg. Outer Right Sequence: caaaagcatcgcagaaaaca. Inner Left Sequence: ctggaagttgtccagatggc. Inner Right Sequence: tccggtgtgaaatgtaacga. Inner primer WT PCR product: 2582. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB791 C. elegans hsp-16.48(ok577) V. Show Description
T27E4.3, T27E4.8. Homozygous. Outer Left Sequence: TGGCATTCCTTCCTTATTGC. Outer Right Sequence: TGAGAAGCCGAGTAGCTGGT. Inner Left Sequence: GTAAGGCTTTCTGCCGTTTG. Inner Right Sequence: TGAGGGCCCTGTAGAAGTTG. Inner primer WT PCR product: 3051. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB825 C. elegans hsp-43(ok647) X. Show Description
C14F11.5. Homozygous. Outer Left Sequence: ATTGCGACTTTCTGAGCGAT. Outer Right Sequence: CCATGTGATCACCCTATCCC. Inner Left Sequence: ATCATTTTTGACCAAAGGCG. Inner Right Sequence: GATCATCATCGTCCAACGTG. Inner primer WT PCR product: 2626. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RBW2642 C. elegans hutSi2642 II; unc-119(ed3) III. Show Description
hutSi2642 [hsp-90p::mCherry::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mCherry from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
RBW2661 C. elegans hutSi2661 II; unc-119(ed3) III Show Description
hutSi2661 [hsp-90p::eGFPT::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mEGFP from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
RG229 Cephalobus sp. Cephalobus sp. Show Description
Cephalobidae family. Cephalobus sp. Isolated by Susan Euling from soil near a roadway in Pontianak, Borneo, Indonesia in December 1994. Family and genus identification by Lynn Carta.
RG3238 C. elegans msp-59(ve738[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 722 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: attggaaggtggcctccacctccaccaaat ; Right flanking sequence: tccccctatcgataaacttcaacactacaa. sgRNA #1: attcaaaagcgtatcaaatt; sgRNA #2: ggcatttcatgtgaattaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3314 C. elegans asp-19(ve814[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCAAAACCTAGACCAACAATGGTTGCAATT ; Right flanking sequence: AGTGCATCTCATGAAAAAAATAGAGACGGG. sgRNA #1: ACCATTACAAAGCAAGAGCT; sgRNA #2: TGCTGTTTTGTAGCTCACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3352 C. elegans asp-5(ve852[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1561 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCACGACCATTTTTCCAGGTATGAAGACCA ; Right flanking sequence: GGGATTCGCCAACTCCCTTCAGGCCAATTA. asp-5 sgRNA #1: GGCAACTAGTGCTACGAAAG; asp-5 sgRNA #2: GATATTGGAGGACAACGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3409 C. elegans tsp-20(ve909[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTTGGGGCTATCACTCAAAGCACAGCCCT ; Right flanking sequence: AGGTATGAAATGAACAATTGACATTTTGAA. tsp-20 sgRNA A: CAAGAGTACACATCAACGGA; tsp-20 sgRNA B: AAACTATACTTACCACAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RGD1 C. angaria Show Description
Male-female strain. This strain is conspecific with PS1010 by mating tests. It was established from a single female. The species was isolated in Sept 2003 by Robin Giblin Davis from an individual of the weevil Metamasius hemipterus. The beetle was collected in Fort Lauderdale, FL. sp. 3 in Kiontke and Sudhaus Wormbook Ecology chapter.
RP1 C. elegans trIs10. Show Description
trIs10 [myo-3p::MB::YFP + myo-2p::YFP + ceh-23::HcRed + unc-25::DsRed + unc-129nsp::CFP].
RP247 C. elegans trIs30. Show Description
trIs30 [him-4p::MB::YFP + hmr-1b::DsRed2 + unc-129nsp::DsRed2].
SB129 C. brenneri Show Description
Male-female strain. Isolated in Bohorok, Sumatra from humus-like material probably from banana plants by P. Blum in June 1975. Conspecific with CB5161 by mating tests, and with CB5161, LKC28 and SB280 by RNA Polymerase II largest subunit sequence. sp. 4 in Kiontke and Sudhaus Wormbook Ecology chapter.
SB146 C. remanei ssp. Caenorhabditis remanei ssp. remanei. Show Description
Rhabditis (Caenorhabditis) remanei ssp. remanei Sudhaus, 1974. Isolated in Freiburg, Germany from compost, associated with pill bugs. Likes to crawl off the plate and dig into the agar. Male/Female strain. Maintain by mating.
SB280 C. brenneri Show Description
Male-female strain. Isolated by W. Sudhaus on Guadeloupe from rotting banana leaves on June 16, 1996. Conspecific with CB5161 by mating tests, and with CB5161, LKC28 and SB129 by RNA Polymerase II largest subunit sequence. sp. 4 in Kiontke and Sudhaus Wormbook Ecology chapter.
SB361 Pellioditis pellio Pellioditis pellio wild isolate. Show Description
Wild type. Species Pellioditis pellio (Schneider, 1866). Type strain (SB361) of the type species (P. pellio) for genus Pellioditis. A neotype specimen (microscope slide) for this species was made from the strain (deposited at the Wageningen type collection). Reference: Tandingan De Ley I, et al. Pellioditis pelhami n. sp. (Nematoda: Rhabditidae) and Pellioditis pellio (Schneider, 1866), earthworm associates from different subclades within Pellioditis (syn. Phasmarhabditis Andrássy, 1976). Submitted.
SB454 C. sulstoni Caenorhabditis sulstoni wild isolate. Show Description
Japonica group, sister of C. afra. From the gut of a millipede Archispirostreptus gigas from Africa, isolated by W. Sudhaus in Feb 2013. Previously known as Caenorhabditis sp. 32.
SD1454 C. elegans ccIs4251 I; stIs10117. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10117 [hsp-3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).
SJ17 C. elegans xbp-1(zc12) III; zcIs4 V. Show Description
zcIs4 [hsp-4::GFP] V. xbp-1(zc12) animals contain a nonsense mutation at residue 11 in the predicted xbp-1 protein. Animals are unable to induce hsp-4::GFP in response to treatment by tunicamycin or heat shock.
SJ30 C. elegans ire-1(zc14) II; zcIs4 V. Show Description
zcIs4 [hsp-4::GFP] V. Animals contain a missense mutation (G739R) in the kinase domain of ire-1. They are unable to induce hsp-4(BiP0 in response to tumincamycin, or heat shock.
SJ4005 C. elegans zcIs4 V. Show Description
zcIs4 [hsp-4::GFP] V. The hsp-4::GFP reporter integrated within the cluster of LG V. Animals express low levels of GFP under basal conditions. However, expression in the gut and hypodermis can increase in response to tunicamycin treatment or heat shock.
SJ4058 C. elegans zcIs9 V. Show Description
zcIs9 [hsp-60::GFP + lin-15(+)]. Stable transgenic line with low basal GFP expression, mainly in the tail, observed from L1 to adult. Induced by perturbations of mitochondrial folding environment.
SJ4100 C. elegans zcIs13 V. Show Description
zcIs13 [hsp-6p::GFP + lin-15(+)]. Stable transgenic line with GFP expression mainly in the tail, observed from L1 to adult. Induced by perturbations of mitochondrial folding environment.
SJ4157 C. elegans zcIs21 V. Show Description
zcIs21 contains [hsp-16p::clpp-1(WT)::3xmyc-His tag + myo-3p::GFP].
SJ4202 C. elegans zcIs22. Show Description
zcIs22 contains [hsp-16p::clpp-1(delta SS)::3xmyc-His tag + myo-3p::GFP].
SJ6 C. elegans zcIs4 V; irg-7(zc6) X. Show Description
zcIs4 [hsp-4::GFP] V. The identity of upr-1 remains unknown. Animals containing the zc6 mutation can be detected in an hsp-4::GFP background by following the bright green tails under fluorescence microscopy.
SP2275 C. elegans tsp-15(sv15) I. Show Description
Hypomorph. Dpy. Hypodermal protrusions.
SS222 C. elegans mes-3(bn21) I. Show Description
Strict maternal effect sterile at 25C. TSP during embryogenesis. The progeny of homozygous mothers, raised at the restrictive temperature, are sterile. Sterile worms have dramatic reduction in number of germ cells (10-100 fold less than WT).
ST66 C. elegans ncIs17. Show Description
ncIs17 contains [hsp-16.2::eGFP + pBluscript]. Superficially wild-type.
TG1681 C. elegans vtIs1 V; tsp-17(gt1681) X. Show Description
vtIs1 [dat-1p::GFP + rol-6] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.