Search Strains

Male-female strain. This is a 20X inbred (one gravid female per generation) derivative of LKC28, which is conspecific with CB5161. This is the strain that will be used for genome sequencing by Erich Schwarz/John Spieth. sp. 4 in Kiontke and Sudhaus Wormbook Ecology chapter.

ubIs4 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains the complete hsp16.48-1 gene pair of locus hsp16A with lacZ cloned in-frame into the second exon of hsp16.1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn4.

ubIs5 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains the complete hsp16.48 and hsp16-1 gene pair of locus hsp16A with lacZ cloned in-frame into the second exon of hsp16.1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn5.

ubIs6 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains a translational fusion to lacZ in which a Sau 3A fragment containing the intergenic region of a hsp16-48 and hsp16-1 gene pair of locus hsp16A was fused in-frame to lacZ to the Sau 3A site in exon of hsp16-1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn6.

syb11029 is a replacement of the asp-1 locus, removing the entire coding sequence and inserting the myo-2p::mCherry reporter. Upstream flanking sequence: tccttcttccaggta. Downstream flanking sequence: gtaggaatggtgtttt. Guide sequences: Sg1:ccaggtaATGCAGACCTTCGTTT Sg2:TTCGCCACCGCCGTCCACAAGGG.

mKate2 tag was inserted into the endogenous hsp-12.6 locus using CRISPR/Cas9. HSP-12.6::mKate2 expression most visible in the muscles. Reference: Koutsoumparis A, et al. Curr Biol. 2022 Apr 26;S0960-9822(22)00581-4. doi: 10.1016/j.cub.2022.04.012. PMID: 35504281

GFP tag inserted into endogenous rsp-1 locus. Reference: Pham K, et al. Genetics. 2021 Mar 3;217(1):1-17. doi: 10.1093/genetics/iyaa016. PMID: 33683371.

Increased lethargus duration and increased movement quiescence during lethargus. syb293 is a clean C-terminal deletion starting from the same position where nas-38(ok3407) is truncated, removes a large part of the TSP domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

wrmScarlet tag inserted at C-terminus of endogenous tsp-6 locus. wrmScarlet expression in ciliated neurons provides a useful marker to track ciliary production of extracellular vesicles. Reference: Razzauti A & Laurent P. Elife. 2021 Sep 17:10:e67670. doi: 10.7554/eLife.67670. PMID: 34533135.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. csEx52 [hsp::lin-45AA + sur-5::GFP]. Array is unstable; pick GFP+ to maintain. Severe Unc.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. csEx52 [hsp::lin-45AA + sur-5::GFP]. Array is unstable; pick GFP+ to maintain.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. csEx52 [hsp::lin-45AA + sur-5::GFP]. Unc slow. Array is unstable, pick GFP+ to maintain.

Defective in chemotaxis to all attractants and to D-tryptophan; partially defective in chemotaxis to CO2(phosphate) and H+(citrate). Thermotaxis weak. p673 previously called tax-3 or daf-21.

Male-female strain. Gonochoristic. Grows well on OP50. Freezes well with C. elegans protocol. Isolated by Robin Giblin-Davis in October 1990 in Dade County, FL in the abdomen of an adult female of Metamasius hemipterus. Consult Walter Sudhaus or Robin Giblin-Davis for appropriate taxonomy before publication. Do not distribute this strain; other labs should request it from the CGC. sp. 3 in Kiontke and Sudhaus Wormbook Ecology chapter.

Wild-type Panagrolaimus isolated in Beijing, China, 1991. Male-female strain.

syIs6 [hsp-16.41p::lin-3]. Chromosomal insertion of the extrachromosomal array syEx23. Do not distribute this strain; other labs should request it from the CGC.

syIs12 [hsp::lin-3 + dpy-20(+)]. "low dose" overexpressor of the EGF repeat of lin-3 under control of the heat shock promoter. Wild type vulval differentiation when grown at 20C. Muv phenotype resulting from heat shock at L2 lethargis. Reference: Katz WS, et al. Cell. 1995 Jul 28;82(2):297-307. Do not distribute this strain; other labs should request it from the CGC.

syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Non-Dpy. Upon heat shock, two intense spots of nuclear fluorescence due to lacO in the chromosome, and a diffuse nuclear fluorescence due to nuclear-localized GFP-lacI. Array derived from Fire Lab vector pPD49-78 and dpy-20 rescuing construct pMH86. Do not distribute this strain; other labs should request it from the CGC.

Strong Dpy. Recessive autosomal. Parental strain Oscheius tipulae CEW1. Do not distribute this strain; other labs should request it from the CGC. AKA Oscheius sp. 1.

Recessive Him. Males mate. Parental strain Oscheius tipulae CEW1. Do not distribute this strain; other labs should request it from the CGC. AKA Oscheius sp. 1.

syIs46 [dpy-30::S65T::lacI + hsp-16p::GFP::lacI + dpy-20(+)] II. Animals are Ncl, Him and Non-Dpy. Heat shock results in diffuse nuclear GFP expression from Fire Lab vector pPD49.78::LacI in most cells. Also see some consitutive GFP expression in embryos from dpy-30 promoter. Do not distribute this strain; other labs should request it from the CGC.

Armenian worm. Male/Female strain. Maintain by mating. Do not distribute this strain; other labs should request it from the CGC.

syIs129 [hemicentin(delta SP)::GFP + unc-119(+)]. Integrant of hemicentin::GFP reporter where the signal has been deleted. Do not distribute this strain; other labs should request it from the CGC.

syTi1 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3'] X. Mapped by Inverse PCR to Chromosome X: (13709433-13709434).

syTi2 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3']. Mapped by Inverse PCR to Chromosome II: (344975-344974).

syIs337 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)].  syIs398 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)].  syIs337 is a GFP cGAL effector. syIs398 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs337 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III.  syIs400 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)] V. syIs337 is a GFP cGAL effector. syIs400 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs337 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III. syIs401 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)].  syIs337 is a GFP cGAL effector. syIs401 is hsp-16.41 cGAL driver for heat shock promoter. Low levels of GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of msp-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTTGGACCCAAAGGAAGCTGTGCTTCTTGCCGTGT Right flanking sequence: CATGCGATGCCTTCGCCTTCGGACAGGAGGACAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGCGAAGGCATCGCATGACA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of msp-40; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAACACCCCGGATGGAGCTGCTAAGCAATTCCGCCG Right flanking sequence: TGAGTGGTTCCAAGGAGACGGCATGGTTCGTCGTAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTCCTTGGAACCACTCACGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of asp-12. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAATCGCCAAAGATGCAAATGATGAGGCGAGGAGA. Right flanking sequence: ATGGGGAGCATACGTTCAACACAAGGCTGCCCTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGATGAGGCGAGGAGAATG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Male-female strain. Low fecundity and fitness. PX356 is an inbred strain derived from EM464. Reference: Fierst JL, et al. PLoS Genet. 2015 Jun 26;11(6):e1005323. doi: 10.1371/journal.pgen.1005323. PMID: 26114425.

fxSi3 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, I:2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. Five generations of lab adaptation following genome editing, all in the CB4856 background. Reference: Kasimatis, KR et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. fxSi6 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, III: 10158855] III. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. fxSi4 was originally inserted in a CB4845 background, but has been sufficiently backcrossed so that PX658 is >98.5% JU2526 genetic background. Reference: Kasimatis, KR. et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

zcIs9 [hsp-60::GFP + lin-15(+)]. Constitutively activated mitochondrial UPR and an extended lifespan. [NOTE: This strains was previously described as only nduf-7(et19). It is in fact carrying the zcIs9 transgene.] Reference: Rauthan M, et al. G3 (Bethesda). 2015 Jun 1. pii: g3.115.018598.

Caenorhabditis sp. 15 Isolated in Kaui (Hawaii) from unidentified wild rotten fruit.

Male-female species. Do not keep below 20C. Elegans group. Reference (type) isolate for Caenorhabditis sp. 51. Isolated from Wongabel State Park, Queensland, Australia, 11 July 2017, and established as isofemale culture. Collection coordinates -17.33115, 145.5041167.

Male-female species. Do not keep below 20C. Stem group. Reference (type) isolate for Caenorhabditis sp. 52. Isolated from rotting mushroom collected at Main Range National Park, Queensland, Australia, 9 April 2017. Collection coordinates -28.02816667, 152.39145.

Male-female strain. Wild type isofemale line of Caenorhabditis sp. 57. Isolated from a rotten fig collected from the forest floor, Barro Colorado Island, Panama, 23 August 2018. Coordinates 9°9.787, 79°50.232.

Male/Female, maintain by mating. Isofemale line isolated from rotting pwuhr fruit (Fagraea berteroana) in Kitti, Pohnpei, Micronesia (N 6.9066, E 158.1817), December 2023. Gonochoristic species in the Elegans Group (sister to C. kamaaina + C. oiwi). Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation.

Male/Female, maintain by mating. Isofemale line isolated from rotting breadfruit flowers in Kitti, Pohnpei, Micronesia (N 6.8632, E 158.1765), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation.

Male/Female, maintain by mating. Isofemale line isolated from rotting Citrus aurantifolia in Kitti, Pohnpei, Micronesia (N 6.8652, E 158.173), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation.

Male/Female, maintain by mating. Isofemale line isolated from a rotting fruit at the Botanical Garden in Kolonia, Pohnpei, Micronesia (), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation.

Male/Female, maintain by mating. Isofemale line isolated from rotting kotop (Clinostigma ponapensis) fruit in Kitti, Pohnpei, Micronesia (N 6.8577, E 158.2156), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation.

Isolated by Annalise Paaby from an orange peel collected beneath a fig tree on State Street, Santa Barbara, CA (34.421629, -119.702021) in July 2010.

Isofemale line. Isolated by M. Rockman from a rotting palm fruit (?) on the Snyder-Molino trail on Barro Colorado Island, Panama (9°09.656' N, 79°50.490'W) on 4/24/12. Previously known as Caenorhabditis sp. 28.

Isofemale line. Isolated by M. Rockman from a rotten Gustavia superba flower on Barro Colorado Island, Panama (9°09.222'N, 79°49.564'W) on 4/25/12. Previously known as Caenorhabditis sp. 29.

vsIs33 [dop-3::RFP] V. gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Reference: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166.

Male-female strain. Isolated by M. Rockman from rotting tomatoes in New Jersey, USA, July 2007. NOTE: To freeze this strain, heat shock at 37°C for 1 hr and add CaCl2 2mM in freezing solution.

Male-female strain. Maintain by mating. Isolated from garden soil in Buenos Aires, Argentina on 3/2/2012.