More Fields
Strain Species Genotype
OS2017 C. elegans hsf-1(sy441) I; nsEx1129. Show Description
nsEx1129 [osm-6p::hsf-1 + hsp-16-2::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP expression in amphids and phasmids following heat shock; some background expression in pharyngeal muscle cells. Reference: Bacaj T, Shaham S. Genetics. 2007 Aug;176(4):2651-5.
OS2723 C. elegans hsf-1(sy441) I; che-2(e1033) X; nsEx1552. Show Description
nsEx1552 [sra-6p::hsf-1 + hsp-16-2::che-2 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Reference: Bacaj T, Shaham S. Genetics. 2007 Aug;176(4):2651-5.
OS2728 C. elegans hsf-1(sy441) I; che-2(e1033) X; nsEx1555. Show Description
nsEx1555 [osm-6p::hsf-1 + hsp-16-2::che-2 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Reference: Bacaj T, Shaham S. Genetics. 2007 Aug;176(4):2651-5.
OS3062 C. elegans hsf-1(sy441) I; nsEx1730. Show Description
nsEx1730 [myo-2p::hsf-1 + hsp-16.2::GFP + hsp-16.41::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Pharyngeal GFP expression following heat-shock. Reference: Bacaj T, Shaham S. Genetics. 2007 Aug;176(4):2651-5.
PB201 C. remanei Cre-unc(bd201). Show Description
Male-female strain. Parental strain is C. remanei ssp. vulgaris. Males and females back poorly, forward movement unaffected. Males are able to mate. Autosomal. Based on phenotype alone (defective in backward movement), it might be orthologous to unc-4. See WBPaper00002633.
PB2801 C. brenneri Show Description
Male-female strain. This is a 20X inbred (one gravid female per generation) derivative of LKC28, which is conspecific with CB5161. This is the strain that will be used for genome sequencing by Erich Schwarz/John Spieth. sp. 4 in Kiontke and Sudhaus Wormbook Ecology chapter.
PC71 C. elegans ubIs4. Show Description
ubIs4 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains the complete hsp16.48-1 gene pair of locus hsp16A with lacZ cloned in-frame into the second exon of hsp16.1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn4.
PC72 C. elegans ubIs5. Show Description
ubIs5 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains the complete hsp16.48 and hsp16-1 gene pair of locus hsp16A with lacZ cloned in-frame into the second exon of hsp16.1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn5.
PC73 C. elegans ubIs6. Show Description
ubIs6 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains a translational fusion to lacZ in which a Sau 3A fragment containing the intergenic region of a hsp16-48 and hsp16-1 gene pair of locus hsp16A was fused in-frame to lacZ to the Sau 3A site in exon of hsp16-1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn6.
PHX1364 C. elegans hsp-12.6(syb1364[hsp-12.6::mKate2]) IV. Show Description
mKate2 tag was inserted into the endogenous hsp-12.6 locus using CRISPR/Cas9. HSP-12.6::mKate2 expression most visible in the muscles. Reference: Koutsoumparis A, et al. Curr Biol. 2022 Apr 26;S0960-9822(22)00581-4. doi: 10.1016/j.cub.2022.04.012. PMID: 35504281
PHX293 C. elegans nas-38(syb293) X. Show Description
Increased lethargus duration and increased movement quiescence during lethargus. syb293 is a clean C-terminal deletion starting from the same position where nas-38(ok3407) is truncated, removes a large part of the TSP domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
PJ1254 C. elegans ccIs55 V; csEx52. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. csEx52 [hsp::lin-45AA + sur-5::GFP]. Array is unstable; pick GFP+ to maintain. Severe Unc.
PJ1256 C. elegans unc-51(e369) ccIs55 V; csEx52. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. csEx52 [hsp::lin-45AA + sur-5::GFP]. Array is unstable; pick GFP+ to maintain.
PJ1270 C. elegans unc-43(n408) IV; ccIs55 V; csEx52. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. csEx52 [hsp::lin-45AA + sur-5::GFP]. Unc slow. Array is unstable, pick GFP+ to maintain.
PR673 C. elegans hsp-90(p673) V. Show Description
Defective in chemotaxis to all attractants and to D-tryptophan; partially defective in chemotaxis to CO2(phosphate) and H+(citrate). Thermotaxis weak. p673 previously called tax-3 or daf-21.
PS1010 C. angaria Show Description
Male-female strain. Gonochoristic. Grows well on OP50. Freezes well with C. elegans protocol. Isolated by Robin Giblin-Davis in Oct. 1990 in Dade County, FL in the abdomen of an adult female of Metamasius hemipterus. Consolt Walter Sudhaus or Robin Giblin-Davis for appropriate taxonomy before publication. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. sp. 3 in Kiontke and Sudhaus Wormbook Ecology chapter.
PS1162 Panagrolaimus sp. Panagrolaimus sp. Show Description
Wild-type Panagrolaimus isolated in Beijing, China, 1991. Male-female strain.
PS1427 C. elegans syIs6. Show Description
syIs6 [hsp-16.41p::lin-3]. Chromosomal insertion of the extrachromosomal array syEx23. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2037 C. elegans syIs12 II. Show Description
syIs12 [hsp::lin-3 + dpy-20(+)]. "low dose" overexpressor of the EGF repeat of lin-3 under control of the heat shock promoter. Wild type vulval differentiation when grown at 20C. Muv phenotype resulting from heat shock at L2 lethargis. Reference: Katz WS, et al. Cell. 1995 Jul 28;82(2):297-307. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2442 C. elegans dpy-20(e1282) IV; syIs44 V. Show Description
syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Non-Dpy. Upon heat shock, two intense spots of nuclear fluorescence due to lacO in the chromosome, and a diffuse nuclear fluorescence due to nuclear-localized GFP-lacI. Array derived from Fire Lab vector pPD49-78 and dpy-20 rescuing construct pMH86. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2617 Oscheius tipulae Oscheius tipulae dpy-6(sy518). Show Description
Strong Dpy. Recessive autosomal. Parental strain Oscheius tipulae CEW1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. AKA Oscheius sp. 1.
PS2626 Oscheius tipulae Oscheius tipulae him-1(sy527). Show Description
Recessive Him. Males mate. Parental strain Oscheius tipulae CEW1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. AKA Oscheius sp. 1.
PS2958 C. elegans syIs46 II; ncl-1(e1865) III; dpy-20(e1282) IV; him-5(e1490) V. Show Description
syIs46 [dpy-30::S65T::lacI + hsp-16p::GFP::lacI + dpy-20(+)] II. Animals are Ncl, Him and Non-Dpy. Heat shock results in diffuse nuclear GFP expression from Fire Lab vector pPD49.78::LacI in most cells. Also see some consitutive GFP expression in embryos from dpy-30 promoter. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS443 Panagrolaimus sp. Show Description
Armenian worm. Male/Female strain. Maintain by mating. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4444 C. elegans unc-119(ed4) syIs129 III. Show Description
syIs129 [hemicentin(delta SP)::GFP + unc-119(+)]. Integrant of hemicentin::GFP reporter where the signal has been deleted. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS7055 C. elegans syTi1 X. Show Description
syTi1 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3'] X. Mapped by Inverse PCR to Chromosome X: (13709433-13709434).
PS7058 C. elegans syTi2 II. Show Description
syTi2 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3']. Mapped by Inverse PCR to Chromosome II: (344975-344974).
PS7169 C. elegans syIs337 syIs398 III. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)].  syIs398 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)].  syIs337 is a GFP cGAL effector. syIs398 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7171 C. elegans syIs337 III; syIs400 V. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III.  syIs400 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)] V. syIs337 is a GFP cGAL effector. syIs400 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7172 C. elegans syIs337 syIs401 III. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III. syIs401 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)].  syIs337 is a GFP cGAL effector. syIs401 is hsp-16.41 cGAL driver for heat shock promoter. Low levels of GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS8992 C. elegans msp-3(sy1594) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of msp-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTTGGACCCAAAGGAAGCTGTGCTTCTTGCCGTGT Right flanking sequence: CATGCGATGCCTTCGCCTTCGGACAGGAGGACAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGCGAAGGCATCGCATGACA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9048 C. elegans msp-40(sy1604) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of msp-40; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAACACCCCGGATGGAGCTGCTAAGCAATTCCGCCG Right flanking sequence: TGAGTGGTTCCAAGGAGACGGCATGGTTCGTCGTAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTCCTTGGAACCACTCACGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PX631 C. elegans fxSi3 I; fxSi4 II; fog-2(q71) V. Show Description
fxSi3 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, I:2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. Five generations of lab adaptation following genome editing, all in the CB4856 background. Reference: Kasimatis, KR et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi:
PX658 C. elegans fxSi1 I; fxSi4 II; fxSi6 III; spe-44(fx123[spe-44::degron]) IV; fog-2(fx111) V. Show Description
fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. fxSi6 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, III: 10158855] III. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. fxSi4 was originally inserted in a CB4845 background, but has been sufficiently backcrossed so that PX658 is >98.5% JU2526 genetic background. Reference: Kasimatis, KR. et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi:
QG122 C. kamaaina Show Description
Caenorhabditis sp. 15 Isolated in Kaui (Hawaii) from unidentified wild rotten fruit.
QG3050 C. sp. 57 Caenorhabditis sp. 57 wild isolate. Show Description
Male-female strain. Wild type isofemale line of Caenorhabditis sp. 57. Isolated from a rotten fig collected from the forest floor, Barro Colorado Island, Panama, 23 August 2018. Coordinates 9°9.787, 79°50.232.
QG555 C. sp. 24 Show Description
Isolated by Annalise Paaby from an orange peel collected beneath a fig tree on State Street, Santa Barbara, CA (34.421629, -119.702021) in July 2010.
QG702 C. panamensis Caenorhabditis panamensis wild isolate. Show Description
Isofemale line. Isolated by M. Rockman from a rotting palm fruit (?) on the Snyder-Molino trail on Barro Colorado Island, Panama (9°09.656' N, 79°50.490'W) on 4/24/12. Previously known as Caenorhabditis sp. 28.
QG704 C. becei Caenorhabditis becei wild isolate. Show Description
Isofemale line. Isolated by M. Rockman from a rotten Gustavia superba flower on Barro Colorado Island, Panama (9°09.222'N, 79°49.564'W) on 4/25/12. Previously known as Caenorhabditis sp. 29.
QV65 C. elegans vsIs33 V; gpIs1. Show Description
vsIs33 [dop-3::RFP] V. gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Reference: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166.
QX1182 C. sp. 8 Show Description
Male-female strain. Isolated by M. Rockman from rotting tomatoes in New Jersey, USA, July 2007. NOTE: To freeze this strain, heat shock at 37°C for 1 hr and add CaCl2 2mM in freezing solution.
QX2263 C. sp. 27 Caenorhabditis sp. 27 wild isolate. Show Description
Male-female strain. Maintain by mating. Isolated from garden soil in Buenos Aires, Argentina on 3/2/2012.
RB1098 C. elegans hsp-12.6(ok1077) IV. Show Description
F38E11.2 Homozygous. Outer Left Sequence: GTGACGATTCGAGAGCAACA. Outer Right Sequence: CGTGCGAAGATTGAACAGAA. Inner Left Sequence: TTCGAAGCTCAATGAACGAA. Inner Right Sequence: AGCCCAAGATGACAATGGAC. Inner Primer PCR Length: 2303. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1104 C. elegans hsp-3(ok1083) X. Show Description
C15H9.6 Homozygous. Outer Left Sequence: GGGGTAGGAGAGCCATTTTC. Outer Right Sequence: ACTTGGCCTTTTCCGATTTT. Inner Left Sequence: CGATCGTTTAGAGCTCGTCC. Inner Right Sequence: CCTGCCGTTTCCATAACAGT. Inner Primer PCR Length: 2947. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1450 C. elegans csp-3(ok1653) I. Show Description
Y47H9C.6. Homozygous. Outer Left Sequence: GGAATCGGAATTGGAACTCA. Outer Right Sequence: CTTCATCGCCACTCACTCAA. Inner Left Sequence: TAATTTCAGCCAATTTGCCC. Inner Right Sequence: CAAACGCCACTGGATTCTCT. Inner Primer PCR Length: 2153 bp. Deletion Size: 1249 bp. Deletion left flank: TCTTTTGAGAGAGCCAATAAGTTTTATTTT. Deletion right flank: TCCGCTTGCGACGACGAGGTTTGGTGTGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1451 C. elegans rsp-5(ok324) II. Show Description
T28D9.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1485 C. elegans csp-2(ok1742) IV. Show Description
Y73B6BL.7. Homozygous. Outer Left Sequence: GCGACGAAGAATGTTCAGGT. Outer Right Sequence: TTATGTCTTGGTGCGTCTCG. Inner Left Sequence: AGATTGATCGGCTTTGCACT. Inner Right Sequence: AGATGCCGACGTCAATTTTC. Inner Primer PCR Length: 3112 bp. Deletion Size: 1722 bp. Deletion left flank: TTTCCAAATTCATAGGAAAAATACTCTGAA. Deletion right flank: TTGCAAATTCTTGAAAGTAAAGTCAACTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1823 C. elegans gst-4&msp-38(ok2358) IV. Show Description
K08F4.7, K08F4.8. Homozygous. Outer Left Sequence: ATGCTGGGTGAAACTAACGG. Outer Right Sequence: AAAGATCTGGGGCAGTGATG. Inner Left Sequence: TCCTCGAACATCGAAACACA. Inner Right Sequence: AAGGTGATCAACTCATCGGC. Inner Primer PCR Length: 2170 bp. Deletion Size: 1548 bp. Deletion left flank: CAAACCTTGGGCAAGAATTTCCAGAGATTG. Deletion right flank: GAATTGTTTGGCAGCGCCATCCGGGGTGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2035 C. elegans asp-4(ok2693) X. Show Description
R12H7.2. Homozygous. Outer Left Sequence: ATCTGTTGCTTAGTGGCGCT. Outer Right Sequence: GTGAACTGATGCTGACCGAA. Inner Left Sequence: CCATGGATTCCTCACTTTCG. Inner Right Sequence: TGCTTCATCACCGTTACGAC. Inner Primer PCR Length: 1185 bp. Deletion Size: 613 bp. Deletion left flank: AGACAGAACGGAATGGTCGTGGAGCTGGAT. Deletion right flank: GAGAAAAGATTCGATGGGACCTTCTTCTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2582 C. elegans tsp-1(ok3594) III. Show Description
C02F5.8 Homozygous. Outer Left Sequence: ccagcattgcaagactcaaa. Outer Right Sequence: aaggactacgccagcttgaa. Inner Left Sequence: ccttgacgtcattccgatct. Inner Right Sequence: tcaaaagtgttagcattaacgaaa. Inner Primer PCR Length: 1252. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807