More Fields
Strain Species Genotype
LL1009 C. elegans hsp-90(nr2081)/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, dead eggs and arrested larvae. Published as LL1008. Previously known as daf-21.
LSD1091 C. elegans smg-1(cc546) I; xchEx91. Show Description
xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
LSD1097 C. elegans smg-1(cc546) I; xchEx97. Show Description
xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
LSD2104 C. elegans xchIs15. Show Description
xchIs15 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C: Prone to transgene suppression at higher temperatures. Rollers. Upon heat shock, human amyloid beta is expressed and secreted into the extracellular space. Aggregates are found in the extracellular space after 16 hours. Generated in N2 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486.
MD4195 C. elegans unc-119(ed3) III; bcSi69 IV. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. [NOTE: MD4195 can be maintained at 20C instead of 15C because it does not carry an array with guide RNAs targeting essential genes.] Generated in parental strain EG8081. Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4571 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1367. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1367 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1367 array contains a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4572 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1368. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1368 [U6p::rrn-1(sgRNAs1-4 targeting the rrn-1 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1368 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4574 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1370. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1370 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-1 locus) + U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1370 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I) and a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MIR260 C. elegans risIs31. Show Description
risIs31 [hsp-16.2p::grh-1b::GFP + unc-119(+)]. Long lived without heat shock. Heat shock induces over-expression of grh-1 causing short-lived phenotype and nuclear GFP expression. Described as "hsp-16.2p::grh-1::gfp OEx line 1" in referenced paper. Reference: Grigolon G, et al. Nat Commun. 2022 Jan 10;13(1):107. doi: 10.1038/s41467-021-27732-4. PMID: 35013237.
MIR276 C. elegans risIs33; gpIs1. Show Description
risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and TJ375.
MQ1050 C. elegans daf-16(m26) I; isp-1(qm150) IV. Show Description
Slow development.
MQ989 C. elegans isp-1(qm150) IV; ctb-1(qm189). Show Description
Slow post-embryonic development and behavior.
MT15883 C elegans csp-2(n4871) IV. Show Description
n4871 is a 1136 bp deletion that removes the last five exons, including the putative protease active site. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.
MT15884 C elegans csp-3(n4872) I. Show Description
n4872 is a 722 bp deletion that removes part of exon 2 and all of exons 3 and 4. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.
MT16846 C elegans csp-1(n4967) II. Show Description
n4967 is a 769 bp deletion that removes the putative protease active site. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.
MT8536 C. elegans nEx648. Show Description
nEx648 [hsp::unc-30 (PD 49-78 and PD 49.3) + rol-6(su1006)]. Pick Rollers to maintain.
NC850 C. elegans unc-119(ed3) III; wdEx351. Show Description
wdEx351 [tsp-7::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in motor neurons. Construct made by M. Vidal lab; candidate unc-37 target gene.
NFB509 C. elegans zdIs13 IV; vlcEx284. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx284 [hsp-16.2p::hlh-3 + ttx-3::mCherry + rol-6(su1006)]. Rollers. Extrachromosomal array containing the heat shock responsive hsp-16.2 promoter for time controlled expression of hlh-3 transcription factor cDNA. Transcriptional tph-1 GFP reporter labels the serotonergic system. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NG324 C. elegans wsp-1(gm324) IV. Show Description
Low penetrance (about 25%) embryonic lethality and reduced brood size. wsp-1(gm324) is an N-terminal deletion that exhibits no observable mRNA or protein.
NIC1070 C. sp. 43 Caenorhabditis sp. 43 wild isolate. Show Description
Male-Female strain. Do not keep below 20C. Reference (type) isolate for Caenorhabditis sp. 43. Gonochoristic species; isofemale line. Isolated from rotting berries in Chichén Itzá, Yucatán, Mexico (2014).
NIC113 C. guadeloupensis Show Description
Caenorhabditis sp. 20 Isolated by Christian Braendle from rotten Heliconia flowers, Souffriere Forest trail Guadeloupe (16.0328, -61.676) in March 2010.
NIC1581 C. sp. 43 Caenorhabditis sp. 43 wild isolate. Show Description
Do not keep below 20C. Male-Female strain. Reference isolate for Caenorhabditis sp. 43 genome sequence. Inbred derivative of NIC1070 (25 generations of inbreeding).
NIC564 C. waitukubuli Caenorhabditis waitukubuli wild isolate. Show Description
Do not keep below 20°C.  Male-female.  Caenorhabditis sp. 39 wild isolate. Gonochoristic species; isofemale line. Isolated from rotting Clusia fruits on the island of Dominica (2014). Previously known as Caenorhabditis sp. 39.
NIS1012 C. elegans kytEx1012. Show Description
kytEx1012 [hsp-12.6p(1kb)::hsp-12.6::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Honjoh S, et al. Nature. 2009 Feb 5;457(7230):726-30.
NIS1013 C. elegans kytEx1013. Show Description
kytEx1013 [hsp-12.6p(5kb)::hsp-12.6::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Honjoh S, et al. Nature. 2009 Feb 5;457(7230):726-30.
NK564 C. elegans unc-119(ed4) III; qyEx78. Show Description
qyEx78 [Venus::unc-6(deltaSP) + unc-119(+)]. Maintain by picking non-Unc.
NKZ392 C. sp 36 Caenorhabditis sp 36 wild isolate. Show Description
Caenorhabditis sp 36 wild isolate. Male-female strain. Maintain by mating. Maintain at 25C. A gonochoristic species isolated from adult weevils (Niphades variegatus), with whom they appear to be tightly associated during its life cycle. A genome comparison highlighted that C. sp. 36 has the smallest genome so far sequenced in the elegans supergroup, despite of being closely related to the largest genome species, C. japonica.
NL1236 C. elegans acy-1(pk393) III; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.
NL1908 C. elegans acy-1(pk866) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL1909 C. elegans acy-1(pk867) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.
NL1921 C. elegans acy-1(pk880) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL1925 C. elegans acy-1(pk884) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.
NL1947 C. elegans acy-1(pk907) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL3161 C. elegans pkIs1330 I; tpa-1(pk1401) dpy-20(e1282) IV. Show Description
pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.
NL3231 C. elegans acy-1(pk484) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL3400 C. elegans pkIs1604. Show Description
pkIs1604 [hsp-16.2::ATG(A)17GFP::LacZ + rol-6(su1006)]. Rollers.
NL3401 C. elegans pkIs1605. Show Description
pkIs1605 [hsp-16.2p::GFP::LacZ + rol-6(su1006)]. Rollers.
NL4258 C. elegans pkIs1330 I; tpa-1(pk1585) dpy-20(e1282) IV. Show Description
pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.
NL4807 C. elegans unc-119(ed3) III; pkIs2170 X. Show Description
pkIs2170 [hsp-16.41::ATG-LacZ(first 251nt)-I-Sce-I site-stops-LacZ + unc-119(+)]. Reference: Pontier DB &Tijsterman M. Nat Methods. 2009 Sep;6(9):655-7.
NL545 C. elegans dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Heat-shock conditions are 2 hours at 33C, which results in degeneration of neurons.
NL585 C. elegans acy-1(pk301) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.
NL587 C. elegans acy-1(pk311) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.
NL597 C. elegans acy-1(pk384) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NM5753 C. elegans jsSi1837 IV. Show Description
jsSi1837 [loxP::mec-4Sp::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3] IV. Single component rapid RMCE landing site on Chromosome IV adjacent to cxTi10882. Created from jsSi1669 (and jsIs1824) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.
NM5922 C. elegans jsSi1944 II. Show Description
jsSi1944 [loxP::mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5937 C. elegans jsSi1971 I. Show Description
jsSi1971 [mosL::loxP + mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5944 C. elegans jsSi1987 V. Show Description
jsSi1987 [loxP + mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NQ570 C. elegans qnIs303 IV. Show Description
qnIs303 [hsp-16.2p::flp-13 + hsp-16.2p::GFP + rab-3p::mCherry] IV. When cultivated at 20 degrees, all animals have red nervous systems. Following heat shock, animals are immobile, do not feed, and show green fluorescence in somatic cells. Reference: Nelson MD, et al. Curr Biol. 2014 Oct 20;24(20):2406-10.
NQ792 C. elegans qnIs303 IV; dmsr-1(qn45) V. Show Description
qnIs303 [hsp-16.2p::flp-13 + hsp-16.2p::GFP + rab-3p::mCherry] IV. Pumps and moves 2 hours after heat induced flp-13 over-expression. Outcrossed 1x to NQ570. Reference: Iannacone M, et al. eLife 2017.
OH10819 C. elegans unc-3(e151) X; vsIs48; otEx4441. Show Description
otEx4441 [hsp-16.2p::unc-3(cDNA) + ttx-3::mCherry]. vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. Maintain by picking mCherry(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.