More Fields
Strain Species Genotype
EGD565 C.elegans egxSi145 II; unc-119(ed3) III. Show Description
egxSi145 [mex-5p::hsp-3(aa1-19)::halotag::HDEL::pie-1 3’UTR + unc-119(+)] II. Superficially wild-type. Stable expression of Halotag in the ER lumen in the germline and embryos. Reference: Fan X, et al. G3 (accepted).
EM434 Pellioditis sp. Pellioditis sp. wild isolate. Show Description
WT strain, Pellioditis sp. See WBG 12(5)14. Male/Female strain. Previously and incorrectly called Rhabditis maupasi by the CGC. Also previously called DF5039.
EM435 Oscheius myriophila Show Description
WT strain. Isolated by D. Fitch in June 1990 from soil in Scott Emmons' compost heap in the Fort Greene section of Brooklyn, NY. A second strain, DF5038, was isolated from the same location one year later from the head and ventral segments of a male pill bug (Armadillidium vulgare). Hermaphroditic. Males are easily isolated by heat shocking L4 or early adult hermaphrodites at 30C for 6-12 hrs. Grows well at 6-25C on OP50. Dauer larvae accumulate under starved or overcrowded conditions. Freezes easily using C. elegans protocols with 90% viability. Previously called Rhabditis sp. See also WBPaper00003418.
EM464 C. remanei ssp. vulgaris Show Description
Male-female strain. Reference WBG 11(4):89. See also WBPaper00001874. May crawl off the plates. Previously called C. vulgaris BK and C. vulgariensis BK. Walter Sudhaus has tentatively described this strain as C. remanei ssp. vulgaris; this description is not official and is contigent upon its being published. See WBPaper00002633 and WBPaper00003993.
EU3020 C. elegans cls-2(or1948)/qC1[dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. or1948 is a CRISPR/Cas9 engineered mutation in cls-1 causing a frameshift and premature stop. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate heterozygotes (WT Rol), lethal qC1 homozygotes, and or1948 homozygotes (lay 100% dead embryos). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. Reference: Schlientz AJ & Bowerman B. (2020) C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion. BioRxiv.
EU3023 C. elegans cls-2(or1951)/qC1[dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. or1951 is a CRISPR/Cas9 engineered mutation in cls-1 causing a frameshift and premature stop. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate heterozygotes (WT Rol), lethal qC1 homozygotes, and or1951 homozygotes (lay 100% dead embryos). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. Reference: Schlientz AJ & Bowerman B. (2020) C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion. BioRxiv.
FT1459 C. elegans unc-119(ed3); xnIs506. Show Description
xnIs506 [cdc42p::GST::GFP::wsp-1(GBD) + unc-119(+)]. Biosensor for active CDC-42. In epithelia, GFP is enriched at junctions between epithelial cells. Some signal is in the nucleus (this signal is reduced by addition of GST, which makes the transgenic protein larger). Reference: Zilberman, Y., J. Abrams, D.C. Anderson, and J. Nance. 2017. Cdc42 regulates junctional actin but not cell polarization in the Caenorhabditis elegans epidermis. J Cell Biol 216: 3729-3744.
FT1547 C. elegans unc-119(ed3) III; xnIs23; xnEx380. Show Description
xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. xnEx380 [hsp-16.41p::zif-1::SL2::mCherry + rol-6(su1006)]. Pick Rollers to maintain. ZF1::GFP::cdc-42 is expressed ubiquitously and enriched at the plasma membrane. In embryos inheriting xnEx380, ZF1::GFP::cdc-42 is degraded and mCherry is expressed after heatshock. Reference: Armenti ST, et al. Development. 2014 Dec;141(23):4640-7.
FX19704 C. elegans tmIn58 I; lig-4(tm750) III. Show Description
Break points: In(gsp-3 sre-23) I. Covered region (Mb) 3.5 (4.7..8.3) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX301 C. elegans gsp-2(tm301) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
tm301 is embryonic lethal. hT2[qIs48] animals are recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX30166 C. elegans tmC18 I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30167 C. elegans tmC18 [dpy-5(tmIs1200)] I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30168 C. elegans tmC18 [dpy-5(tmIs1236)] I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Balancer marked with myo-2p::mCherry. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30176 C. elegans tmC20 I. Show Description
Break points: In(F53G12.8 T02E1.7 In(gsp-3 sre-23)) I. Covered region (Mb) 8.1 (0.1..8.3) Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30177 C. elegans tmC20 [unc-14(tmIs1219)] I. Show Description
Break points: In(F53G12.8 T02E1.7 In(gsp-3 sre-23)) I. Covered region (Mb) 8.1 (0.1..8.3) Balancer marked with myo-2p::Venus. tmIs1219 is inserted in unc-14, but Unc phenotype is not detectable. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30179 C. elegans tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
Break points: In(F53G12.8 T02E1.7 In(gsp-3 sre-23)) I. Covered region (Mb) 8.1 (0.1..8.3) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30235 C. elegans tmC20 [dpy-5(tm9709)] I. Show Description
Break points: In(F53G12.8 T02E1.7 In(gsp-3 sre-23)) I. Covered region (Mb) 8.1 (0.1..8.3) Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30238 C. elegans tmC18 [dpy-5(tm9705)] I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
GC773 C. elegans unc-119(ed3) III; naIs3. Show Description
naIs3 [(pGC133) hsp-16.41::FLP:::let-858 3'UTR) + Cbr-unc-119(+)].
GC817 C. elegans unc-119(ed3) III; naIs6. Show Description
naIs6 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+) + ceh-22p::GFP)].
GC822 C. elegans unc-119(ed3) III; naEx75. Show Description
naEx75 [(pGC146) hsp-16.2p::FLP::let-858 3'UTR) + Cbr-unc-119(+) + (pCW2.1) ceh-22p::GFP)]. Array was bombarded but did not integrate.
GC827 C. elegans unc-119(ed3) III; naIs7. Show Description
naIs7 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+)]. Does not express ceh-22p::GFP, but unc-119 is rescued.
GL347 C. elegans zcIs13 V. Show Description
zcIs13 [hsp-6p::GFP + lin-15(+)] V. Stable transgenic line with GFP expression mainly in the posterior intestine, observed from L1 to adult. Perturbation of mitochondrial folding environment induces robust GFP expression throughout the intestines. Derived by outcrossing parental strain SJ4100 to N2 six times to remove suspected background mutations causing uneven transgene expression and low penetrance of sterility.
GLW47 C. elegans hsp-4(utx39[hsp-4::mNG::3xFlag]) II. Show Description
C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46.
GLW57 C. elegans asp-3(utx47[mNG::3xFlag::asp-3]) X. Show Description
N-terminal tag of ASP-3 via CRISPR/Cas9 knock-in of mNeonGreen at asp-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcgctgcttctcaattagtgataacgcacc 3'; Right flank: 5' ATGTCGGGCCGCGTTTTCCTTCTTCTGGCT 3'; sgRNA: tagtgataacgcaccATGT (19 bp); Cas9/sgRNA plasmid: pGLOW74; mNG^SEC^3xFlag plasmid: pGLOW96; SEC insertion allele strain: GLW58.
GOU1861 C. elegans wsp-1a(cas723[gfp::wsp-1a] IV; arx-2(cas725[arx-2::TagRFP]) V. Show Description
Constructed by crossing individual fluorescence knock-in worms. TagRFP inserted into the endogenous arx-2 gene at its C-terminus and GFP inserted into the endogenous wsp-1a gene at its N-terminus by Cas9-triggered homologous recombination.
GR2252 C. elegans hsp-6(mg585) V; mgIs73 V. Show Description
mgIs73 [cyp-14A4p::GFP::cyp-14A4 3’UTR + myo-2p::mCherry] V. Slow growth. Low brood size. Received as a replacement for GR2249. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.
GS1826 C. elegans dpy-20(e1282) IV; arIs36. Show Description
arIs36 [(pJF43) hsp::ssGFP + dpy-20(+) + pBluescript SK+]. GFP is secreted into the pseudocoelom upon heat shock and is taken up by coelomocytes. Not known where arIs36 is attached. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GW1262 C. elegans xeSi302 II; gwIs114. Show Description
xeSi302 [nhx-2p::npp-9::GFP::BLRP::3xFLAG::unc-54 3'UTR + Cbr-unc-119(+)] II. gwIs114 [hsp-16.2p::hlh-1 + rol6(su1006)]. Intestine-specific expression of nuclear GFP reporter. Rollers have heat-shock-inducible expression of hlh-1 transcription factor. gwIs114 was generated using constructs provided by Michael W. Krause`s lab (NIDDK). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.
GW421 C. elegans gwIs39 III; gwIs58. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs58 [hsp-16.2p::mCherry::256xLacO::4xLexA + unc-119(+)]. Small transgene/large array. Superficially wild-type. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have green intestine (from late L4 stage). Might still carry unc-119(ed3) in background. Reference: Rohner S, et al. J Cell Biol. 2013 Mar 4;200(5):589-604. doi: 10.1083/jcb.201207024. PMID: 23460676
GW597 C. elegans gwIs39 III; dpy-13(eI84) ama-1(m118m251) IV; gwIs58. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs58 [hsp-16.2p::mCherry::256xLacO::4xLexA + unc-119(+)]. Small transgene/large array. Slow growing and dumpy. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have green intestine (from late L4 stage). Might still carry unc-119(ed3) in background. Reference: Rohner S, et al. J Cell Biol. 2013 Mar 4;200(5):589-604. doi: 10.1083/jcb.201207024. PMID: 23460676
HBR1021 C. elegans goeIs240. Show Description
goeIs240 [hsp-16.2p::flp-11::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Likely intergrated into LG I or LG III. Heat shock-induced over-expression of FLP-11 neuropeptide causes behavioral quiescence. Reference: Turek et al. eLife 2016;5:e12499.
HBR1549 C. elegans goeIs326. Show Description
goeIs326 [hsp-16.2p::nlp-29::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-29::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1896 C. elegans goeIs388. Show Description
goeIs388 [hsp-16.2p::cnc-1::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-1::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1897 C. elegans goeIs397. Show Description
goeIs397 [hsp-16.2p::cnc-10::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-10::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1899 C elegans goeIs406. Show Description
goeIs406 [hsp-16.2p::nlp-31::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-31::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1900 C. elegans goeIs408. Show Description
goeIs408 [hsp-16.2p::nlp-27::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-27::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1901 C. elegans goeIs407. Show Description
goeIs407 [hsp-16.2p::cnc-2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-2::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1902 C. elegans goeIs409. Show Description
goeIs409 [hsp-16.2p::nlp-32::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-32::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1907 C. elegans goeIs410. Show Description
goeIs410 [hsp-16.2p::cnc-6::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-6::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1911 C. elegans goeIs411. Show Description
goeIs411 [hsp-16.2p::cnc-4::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-4::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1912 C. elegans goeIs412. Show Description
goeIs412 [hsp-16.2p::cnc-7::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-7::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1914 C elegans goeIs413. Show Description
goeIs413 [hsp-16.2p::cnc-9::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-9::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1961 C. elegans goeIs431. Show Description
goeIs431 [hsp-16.2p::nlp-25::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-25::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
JH2168 C. elegans unc-119(ed3) III; axIs1569. Show Description
axIs1569 [pie-1p::GFP::msp-142 ORF::msp-142 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2316 C. elegans unc-119(ed3) III; axIs1673. Show Description
axIs1673 [pie-1p::GFP::histone H2B::msp-142 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2435 C. elegans unc-119(ed3) III; axIs1759. Show Description
axIs1759 [msp-56p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)].
JK3782 C. elegans qIs56 him-5(e1490) V; qEx557. Show Description
qIs56 [lag-2p::GFP + unc-119(+)] V. qEx557 [hsp-16p::ceh-22b + ttx-3::DsRed]. Him. Pick DsRed+ animals to maintain qEx557 array. Heat-shock can be used to drive the ectopic expression of CEH-22B (derived from Fire Lab vector pPD49.78). LAG-2::GFP is expressed the embryo, nerve cord, Z1/Z4, and DTCs. Reference: Lam N. et al. Curr Biol. 2006 Feb 7;16(3):287-95. doi: 10.1016/j.cub.2005.12.015. PMID: 16461282
JN147 C. elegans gap-2(tm748) X. Show Description
No apparent phenotype. tm748 is a UV/TMP-induced gap-2 deletion allele generated by National Bioresource Project (see http://shigen.lab.nig.ac.jp/c.elegans/index.jsp?lang=englis h for info).
JN1713 C. elegans peIs1713. Show Description
peIs1713 [sra-6p::mCasp-1 + unc-122p::mCherry]. ASH neurons are eliminated. Abnormal odor chemotaxis. Reference: Yoshida K, et al. Nat Commun. 2012 Mar 13;3:739.