Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
NM306 C. elegans jsIs1. Show Description
jsIs1 [(pSB120) snb-1::GFP + rol-6(su1006)]. Rollers. GFP expressed in the nerve ring, ventral cord and dorsal cord. Received new stock 3/10/2008 from Mike Nonet. Faint signal using a dissecting microscope. Obvious signal using a compound microscope (40X oil).
NM467 C. elegans snb-1(md247) V. Show Description
Aldicarb resistant. Lethargic Unc - jerky especially in backward movement. Low pumping rate. Molecular lesion for md247 is a 20 bp duplication yielding a frameshift mid-way through the transmembrane domain.
NM534 C. elegans snb-1(js17) V. Show Description
Aldicarb resistant. Unc. L62F mutant (C to T in first base of codon).
NM833 C. elegans snb-1(js44) V. Show Description
Aldicarb resistant. Unc. A65G mutant (C to T in second base of codon).
RM3659 C. elegans snb-1(e1563) V. Show Description
e1563 homozygotes are superficially wild-type in appearance, development, and behavior. e1563 is a strong, dominant suppressor of UNC-17 G347R mutations (including e245, e359, p300). Molecular details: e1563 corresponds to an I97D (att>>gat) missense mutation in the SNB-1 transmembrane domain. Reference: Sandoval GM, et al. Nat Neurosci. 2006 May;9(5):599-601.
CB3031 C. elegans unc-17(e245) IV; snb-1(e1563) V. Show Description
Dominant suppressor of Unc. Movement almost WT.
NM440 C. elegans unc-104(e1265) II; jsIs1. Show Description
jsIs1 [(pSB120) snb-1::GFP + rol-6(su1006)]. Roller. Unc. GFP expressed in the nerve ring, ventral cord, dorsal cord.
RM3645 C. elegans unc-17(e245) IV; snb-1(e1563) V. Show Description
Almost full suppression of all unc-17 mutant phenotypes; animals are superficially wild type in appearance, development, and behavior, and males mate well. For additional information, see descriptions of the RM908 unc-17(e245) IV and the RM3659 snb-1(e1563) V single mutant strains. Reference: Sandoval GM, et al. Nat Neurosci. 2006 May;9(5):599-601.
NM1081 C. elegans snb-1(js124)/dpy-11(e224) unc-68(r1158) V. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and L1 lethals. js124 homozygotes arrest as L1 larvae that are very uncoordinated and tend to adopt a coiled position. js124 molecular lesion is an amber mutation at codon 50.
CB933 C. elegans unc-17(e245) IV. Show Description
M-MATING-NO SUCCESS. UNC-Severe coiler at all stages-small and thin. SCORED EASILY. Suppressed by sup-1, sup-2, and snb-1. Resistant to lannate. See also CGC 1770.
CL2355 C. elegans smg-1(cc546) dvIs50 I. Show Description
dvIs50 [pCL45 (snb-1::Abeta 1-42::3' UTR(long) + mtl-2::GFP] I. Maintain at 16C. Pan-neuronal expresion of human Abeta peptide. Constitutive intestinal expression of GFP from marker transgene. Strain shows deficits in chemotaxis, associative learning, and thrashing in liquid. Strain also has incomplete sterility due to germline proliferation defects and embryonic lethality. Maintain at 16 C to reduce selection against transgene, although this does not alter the partial sterility. Reference: Wu Y., et al. J Neurosci. 2006 Dec 13;26(50):13102-13. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CX3572 C. elegans kyIs105 V; lin-15B&lin-15A(n765) X. Show Description
kyIs105 [str-3p::snb-1::GFP + lin-15(+)]. Also known as str-3::VAMP::GFP or ASI::VAMP::GFP or M7::VAMP::GFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX652 C. elegans kyIs235 V; syg-1(ky652) X. Show Description
kyIs235 [unc-86::snb-1::YFP + unc-4p::lin-10::RFP(intron) + odr-1::RFP]. Also known as unc-86::VAMP::YFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CZ2060 C. elegans juIs137 II. Show Description
juIs137 [flp-13p::snb-1::GFP] II. GFP expression labels synaptic vesicles. Reference: Sakaguchi-Nakashima A, et al. Curr Biol. 2007 Apr 3;17(7):592-8. doi: 10.1016/j.cub.2007.01.074. PMID: 17346966.
CZ333 C. elegans juIs1 IV. Show Description
juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. GFP expression in presynaptic terminals of GABAergic DD and VD motor neurons and RME neurons. Maintain under normal conditions. Reference: Hallan SJ and Jin Y. Nature. 1998 Sep 3;395(6697):78-82.
DCR3791 C. elegans pfk-1.1(ola72) X. Show Description
Diffuse distribution of synaptic vesicle markers (SNB-1, CAT-1, and RAB-3) under hypoxic conditions. pfk-1.1(ola72) causes C562Y missense mutation. Reference: Jang et al. Neuron. 2016 Apr 20;90(2):278-91.
EG10288 C. elegans unc-119(ox819) III; snb-1(ox1124[attB::snb-1]) V. Show Description
N-terminal PhiC31 attB site inserted at the 5' end of the endogenous snb-1 coding sequence. Unc; can be rescued by expression of the C. briggsae unc-119 gene (Cbr-unc-119). Reference: Hefel A, et al. bioRxiv. 2026 Jan 15:2026.01.15.699741. doi: 10.64898/2026.01.15.699741. PMID: 41648400.
HA2823 C.elegans smn-1(rt248) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); nuIs175 X. Show Description
nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752.
HA2825 C.elegans smn-1(ok355) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); rtSi10 IV; nuIs175 X. Show Description
rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752
IK575 C. elegans ttx-7(nj40) I. Show Description
Weak allele. Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of SNB-1:GFP is abnormal in RIA interneurons.
IK591 C. elegans ttx-7(nj51) I. Show Description
Putative null allele which lacks whole of the 3rd exon of the gene (lacking 260 bp area corresponding to 12984-13243 of the cosmid F13G3). Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of SNB-1::GFP is abnormal in RIA interneurons.
IK721 C. elegans njIs9 IV. Show Description
njIs9 [glr-3p::snb-1::venus + ofm-1::GFP] IV.
JT10189 C. elegans daf-14(m77) IV; scd-2(sa935) V. Show Description
Daf-c strongly but not completely suppressed; some dauers visible at 25C. sa935 alone is moderate Daf-d (dauer defective) in plate starvation assays, and resistant to exogenous dauer pheromone. sa935 confers strong suppression of daf-8 and daf-14, weak suppression of daf-1, -4, -7. scd-2(sa935) single mutant looks WT. snb-1(md247) hypomorph is an excellent balancer for scd-2; snb-1 is immediately neighboring. Maintain at 15 degrees.
KP3085 C. elegans nuIs122 IV. Show Description
nuIs122 [acr-2p::pHluorin::snb-1 + myo-2p::dsRed2] IV. Integrated transgene expressing synaptopHluorin under a cholinergic promoter for imaging motor neuron synapses.
KP3814 C. elegans nuIs152 II. Show Description
nuIs152 [unc-129p::GFP::snb-1 + ttx-3p::mRFP] II.
KRA315 C. elegans kasIs7. Show Description
kasIs7 [snb-1p::C9 ubi + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of snb-1 promoter. The repeats are flanked with human C9orf72 intronic sequences. Reference: https://pubmed.ncbi.nlm.nih.gov/34654821/
KRA317 C. elegans kasIs9. Show Description
kasIs9 [snb-1p::(delta)C9 ubi + myo-2::GFP]. The transgene has the snb-1 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: https://pubmed.ncbi.nlm.nih.gov/34654821/
KRA522 C. elegans kasIs10. Show Description
kasIs10 [snb-1p::UAG ubi + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of snb-1 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
LX967 C. elegans lin-15B&lin-15A(n765) vsIs103 X. Show Description
vsIs103 [tph-1p::RFP + snb-1::GFP + lin-15(+)] X. RFP expression in HSN and NSM neurons.
MAH677 C. elegans sid-1(qt9) V; sqIs71. Show Description
sqIs71 [rgef-1p::GFP + rgef-1p::sid-1]. Pan-neuronal expression of sid-1 driven by the rgef-1 promoter. Expression remains neuron-specific until at least Day 10. Animals respond to feeding RNAi against gfp and neuronal genes snb-1 and unc-13. In contrast, animals are resistant to phenotypes induced by feeding RNAi constructs targeting non-neuronal genes pept-1, unc-112, bli-1 and die-1. Reference: Yang Y, et al. Nat Aging 2024 Jan 4. doi: 10.1038/s43587-023-00548-1. PMID: 38177330. MAH677 effectively replaces strain TU3401 sid-1(pk3321) uIs69 [pCFJ90 (myo-2p::mCherry) + unc-119p::sid-1] V., which was found to show RNAi response in non-neuronal tissues.
NC571 C. elegans dpy-20 (e1282) IV; wdIs20. Show Description
wdIs20 [unc-4p::snb-1::GFP + dpy-20(+)]. Animals are Lon, likely due to dpy-20(+) overexpression. Punctate GFP expression observed in dorsal nerve cord, ventral nerve cord, VC4, and VC5. Reference: Lickteig KM, et al. J Neurosci. 2001 Mar 15;21(6):2001-14.
NK2827 C. elegans snb-1(qy164[snb-1::mNG]) V. Show Description
mNG tag inserted into the C-terminus of the endogenous snb-1 locus.
NM1448 C. elegans jsIs37 rpm-1(js410) V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Reduced SNB-1::GFP localization to synaptic regions; slighty Dpy. js410 has linked phenotype of reduced brood size. js410 is an R->Stop at aa 235. snb-1::GFP is expressed in mechanosensory neurons visible in the cell body and in the axon (very low levels). GFP puncta absent from the ventral nerve cord due to rpm-1 lesion.
NM1455 C. elegans jsIs37 rpm-1(js317) V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Reduced SNB-1::GFP localization to synaptic regions; slighty Dpy. js317 is a W->Stop at aa 861. snb-1::GFP is expressed in mechanosensory neurons visible in the cell body and in the axon (very low levels). GFP puncta absent from the ventral nerve cord due to rpm-1 lesion.
NM1489 C. elegans dhc-1(js319) I; jsIs37 V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope.May be slightly Unc. dch-1 alias sam-11.
NM2040 C. elegans dhc-1(js121) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); jsIs37 V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Heterozygotes are GFP+ in the pharynx. dhc-1 homozygotes are GFP- and sterile or partially sterile pvuls. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP js121 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
NM664 C. elegans jsIs37 IV; lin-15B&lin-15A(n765) X. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope.
OH11054 C. elegans pha-1(e2123) III; him-8(e1489) IV; ntIs1 V; otIs305; otEx4445. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)]. otEx4445 [snb-1::NLS::RFP + pBX]. Rollers. Maintain by picking RFP+ Rollers. Maintain at 20C to maintain extrachromosomal array. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
OH13421 C. elegans pha-1(e2123) III; otIs356 V; otEx6254. Show Description
otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx6254 [snb-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx6254. Ubiquitous nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OK1083 C. elegans cuEx828. Show Description
cuEx828 [ceh-19p::snb-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. SNB-1::GFP expression specifically marks synaptic vesicles in the MC pharyngeal neuron. Reference: Kozlova AA, et al. Genetics. 2019 May;212(1):231-243. doi: 10.1534/genetics.119.302053. PMID: 30898771.
RK1 C. elegans unc-13(e323) I; jsIs1. Show Description
jsIs1 [(pSB120) snb-1::GFP + rol-6(su1006)]. Roller Unc.
WG291 C.elegans rmIs190; hdEx1. Show Description
rmIs190 [F25B3.3p::Q67::CFP]. hdEx1 [snb-1::ALKBH3::BFP::tbb-2 3’UTR + rol-6(su1006)]. Pick Rollers to maintain. BFP fused to the C-terminus of wild-type ALKBH3. Pan-neuronal CFP expression. Reference: Sun Y, et al. Nature. 2023 Nov;623(7987):580-587. doi: 10.1038/s41586-023-06701-5. PMID: 37938769.
WG300 C.elegans rmIs190; hdEx2. Show Description
rmIs190 [F25B3.3p::Q67::CFP]. hdEx2 [snb-1::ALKBH3(H257A)::BFP::tbb-2 3’UTR + rol-6(su1006)]. Pick Rollers to maintain. BFP fused to the C-terminus of catalytically inactive ALKBH3(H257A) mutant form of ALKBH3. Pan-neuronal CFP expression. Reference: Sun Y, et al. Nature. 2023 Nov;623(7987):580-587. doi: 10.1038/s41586-023-06701-5. PMID: 37938769.
ZM10040 C. elegans hpIs721. Show Description
hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. Transgenic animals have pharyngeal RFP expression and SNB-1::GFP expression in AVA (soma and along the VNC).
ZM10786 C. elegans hpIs721; hpIs811. Show Description
hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. hpIs811 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::Cherry + twk-40p(short)::Cre]. Transgenic animals have pharyngeal RFP signal; GFP puncta are visible in AVA soma but not along the VNC; RFP signals along AVA neurite.
ZM11284 C. elegans twk-40(bln336) III; hpEx4479. Show Description
hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(bln336) is a gain-of-function allele. Paralyzed; no backward movement upon head touch. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with weaker expression than in a wild-type background.
ZM11285 C. elegans twk-40(hp834) III; hpEx4479. Show Description
hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(hp834) is a loss-of-function allele. Loopy. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background.
ZM11286 C. elegans hpIs636; hpEx4479. Show Description
hpIs636 [rig-3p::HisCl1::SL2::mCherry]. hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. Synapse exocytosis marker in AVA. Transgenic animals exhibit punctate green fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background. mCherry and HisCl1 expression in AVA soma and neurites. In the presence of histamine, the SNB-1::pHluorin intensity will decrease in neurites.
ZM1157 C. elegans daf-2(e1370) III; juIs1 IV. Show Description
juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM588 C. elegans fsn-1(hp1) III; juIs1 IV; scd-2(ok565) V. Show Description
juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Animals are WT looking. In WT, GABAergic synapses visualized with juIs1 (GABAergic nervous system specific synaptobrevin::GFP) marker show uniformly spaced and sized puncta. fsn-1(hp1); scd-2(ok565) animals have puncta close to WT shape. This is more evident in larvae than in adults.