More Fields
Strain Species Genotype
OH3890 C. elegans otIs114 I; ced-4(ot188) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers.
OH3895 C. elegans otIs114 I; die-1(ot198) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of die-1 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3900 C. elegans otIs114 I; fozi-1(ot191) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
OH3902 C. elegans otIs114 I; cog-1(ot200) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot200. Rollers.
OH3903 C. elegans otIs114 I; cog-1(ot201) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot201. Rollers.
OH3923 C. elegans otIs114 I; ced-4(ot228) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers.
OH3957 C. elegans otIs114 I; ced-4(ot248) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers.
OH3959 C. elegans otIs114 I; die-1(ot231) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of die-1 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3962 C. elegans otIs114 I; fozi-1(ot236) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
OH3963 C. elegans otIs114 I; ced-4(ot238) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers.
OH3966 C. elegans otIs151; otEx2304. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2304 [gcy-11(prom1)::GFP + unc-122::GFP]. Expresses GFP in pharyngeal muscle. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH3972 C. elegans otIs151; otEx2310. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2310 [gcy-19(prom1)::GFP + unc-122::GFP]. Expresses GFP in IL2, faint in ASEL/R, and faint pairs in head. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH3976 C. elegans otIs151; otEx2314. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2314 [gcy-2(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASI, RIA, PVT and AWA. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH3992 C. elegans otIs151; otEx2322. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2322[gcy-14(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASEL, and dim GFP in ASER and AWC. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH3997 C. elegans otIs151; otEx2327. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2327 [gcy-20(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASEL, dim in ASER and AWC. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4013 C. elegans otIs114 che-1(ot232) I. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH4027 C. elegans otIs114 I; fozi-1(ot234) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
OH4158 C. elegans otIs151; otEx2409. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2409 [gcy-4(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASE, biased to right. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4160 C. elegans otIs151; otEx2411. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2411[gcy-13(prom1)::GFP + unc-122::GFP]. Expresses GFP in RIM. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4163 C. elegans otIs151; otEx2414. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2414 [gcy-17(prom1)::GFP + unc-122::GFP]. Expresses GFP in PHA. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4165 C. elegans otIs151; otEx2416. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2416 [gcy-21(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASG and ADL(weak). Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4168 C. elegans otIs151; otEx2419. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2419 [gcy-1(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASER, ASI, URX, PVT, and AIY. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4172 C. elegans otIs151; otEx2423. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2423[gcy-3(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASER. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4174 C. elegans otIs151; otEx2425. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2425 [gcy-25(prom1)::GFP + unc-122::GFP]. Expresses GFP in AQR, PQR, URX. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4176 C. elegans otIs114 I; cog-1(ot242) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot242.
OH4177 C. elegans otIs114 I; ced-4(ot248) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers.
OH4309 C. elegans otIs151; otEx2491. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2491[gcy-29(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASE and AWC. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4346 C. elegans otIs151; otEx2501. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2501[gcy-23(prom1)::GFP + unc-122::GFP]. Expresses GFP in AFD. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4350 C. elegans otIs151; otEx2504. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2504 [gcy-28(prom1)::GFP + unc-122::GFP]. Expresses GFP in many head neurons, ventral cord and tail neurons, body wall muscle, hypodermis, somatic germline and intestine. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4397 C. elegans otIs151; lsy-6(ot71) dpy-11(e224) V; otEx2419. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2419 [gcy-(prom1)::GFP + unc-122::GFP]. Bilateral expression of GFP in ASE. Expresses bright GFP in coelomocytes. Rollers. Dpy. Maintain by picking GFP+.
OH4400 C. elegans lim-6(nr2073) X; otEx2322. Show Description
otEx2322 [gcy-14(prom1)::GFP + unc-122::GFP]. ASEL biased GFP expression. Expresses bright GFP in coelomocytes.
OH4605 C. elegans unc-37(ot59)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); him-8(e1489) IV; otIs3 V. Show Description
Heterozygotes are WT and GFP+ in the pharynx. ot59 is homozygous inviable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. otIs3[lin-15(+) + gcy-7::GFP]. otIs3 is expressed in ASEL in WT animals. In this ot59 strain, otIs3 is expressed in ASEL and ASER.
OH4974 C. elegans otIs114 I; lsy-12(ot89) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers.
OH707 C. elegans cog-1(ot38)/+ II; otIs114 I. Show Description
otIs114 [lim-6::GFP + rol-6(su1006)]. Rollers. Heterozygous strain. Heterozygotes should be fertile and segregate some sterile progeny. Maintain by picking plenty of animals with GFP in both ASEL and ASER; many of them will be sterile (homozygotes). otIs114 is normally expressed only in ASEL and excretory gland cell. Homozygous ot38; otIs114 is sterile and expresses GFP in both ASEL and ASER neurons. Heterozygotes display a semi-dominant, partially penetrant "ASEL + ASER" phenotype.
OH7317 C. elegans F21H12.1(ot86) rol-6(e187) II; ntIs1 V. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. Ectopic expression of ntIs1 in ASEL. Rollers. Whole genome sequenced strain.
OH8001 C. elegans otIs114 I; lsy-12(ot177) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers. Whole genome sequenced strain.
OH8993 C. elegans otIs252. Show Description
otIs252 [lsy-6(fosmid)::YFP + rol-6(su1006)]. Rollers. YFP expression in ASEL.
OH9016 C. elegans ntIs1 V; lsy-2(ot90) X. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. Loss of ASEL fate. 2 cells GFP+ for ASER marker.
OH9370 C. elegans otIs232; otEx4149. Show Description
otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. otEx4149 [cog-1(fosmid)::YFP + elt-2::DsRed]. Maintain by picking animals dsRed(+) in gut nuclei. Rollers. mCherry expression in ASER and ASEL.
OH9838 C. elegans otIs232; otEx4359. Show Description
otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. Rollers. mCherry expression in ASER and ASEL. otEx4359 [die-1(prom8)::2NLS::YFP + elt-2::DsRed]. Pick animals with dsRed+ intestinal nuclei to maintain otEx4359. otEx4359 carries a minimal (1 kb) promoter driving 2NLS::YFP only in ASEL.
PS8650 C. elegans syIs680; syIs300. Show Description
syIs680 [gcy-5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASEL neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
RB1432 C. elegans sel-10(ok1632) V. Show Description
F55B12.3. Homozygous. Outer Left Sequence: CAGTGACCATCGAACACCTG. Outer Right Sequence: TACGAGATCCGACTGCACAC. Inner Left Sequence: ATCAAGTGAACAAACGTGCG. Inner Right Sequence: AATACAGCCACCATTGCCTC. Inner Primer PCR Length: 3118 bp. Deletion Size: 901 bp. Deletion left flank: ATGGATGATGGATCGATGACACCGGAGGAC. Deletion right flank: TTAGTATTATCTTTTCAGAGACCGAGTTAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1672 C. elegans sel-12(ok2078) X. Show Description
F35H12.3. Homozygous. Outer Left Sequence: CCTCTTCCTCCTTTTCACCC. Outer Right Sequence: CGACAGTTGTGGTTTCCTCC. Inner Left Sequence: ACGTTTCAGATGCCTTCCAC. Inner Right Sequence: ATGATCCAGCGGGTACAAAA. Inner Primer PCR Length: 2248 bp. Deletion Size: 1525 bp. Deletion left flank: TCTGGTTGTTTTTACGATGAACACGATTAC. Deletion right flank: TCAGCTGAATATATTTTGTTCATTTAAAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB638 C. elegans sel-5(ok363) III. Show Description
F35G12.3A. Homozygous. Outer Left Sequence: CACTGAGCAATTGCCTTTCA. Outer Right Sequence: ATCGCCGAAGGTAGGTTTTT. Inner Left Sequence: CAAACACATCATCCACCACC. Inner Right Sequence: TTTCTTCCAGGTGGATTTGC. Inner primer WT PCR product: 3269. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
SYS604 C. elegans ujIs113 II; sel-8(dev176([sel-8::mNeonGreen]) III. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3Â’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of sel-8 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
UDN100039 C. elegans sel-2(udn20) III. Show Description
Variant edit allele, G1514R. SpeI restriction site created by synonymous changes for ease of genotyping.
UDN100043 C. elegans sel-2(udn24) III. Show Description
Control edit allele, G1514G. SpeI restriction site created by synonymous changes for ease of genotyping.
VC312 C. elegans +/mT1 II; sel-8(ok387)/mT1 [dpy-10(e128)] III. Show Description
C32A3.1. Heterozygotes are WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous ok387 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3824 C. elegans sel-11(gk3792[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2037 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGTGGCTCGTGTGTGGCGACTGCGGCCA; Right flanking sequence: CGGACCGTCAACAGATCAAGTCACTTCGGA. See WormBase Variation gk3792 for details.
VS30 C. elegans hjSi158 I. Show Description
hjSi158 [vha-6p::SEL-1(1-79)::mCherry::HDEL::let-858 3'UTR ]. Targeting construct derived from pCFJ352. Reference: Klemm RW, et al. Cell Rep. 2013 May 30;3(5):1465-75.