| CB1489 |
C. elegans |
him-8(e1489) IV. Show Description
37% XO self-progeny. 6% XXX self-progeny. Recessive. M-MATING++ 1-10%WT. [Background mutation that causes rays 8 and 9 to fuse.] |
|
| CB1511 |
C. elegans |
him-10(e1511) III. Show Description
Temperature sensitive. 2% XO self-progeny at 15C, 12% at 20C, and 27% at 25C. M-MATING++++ >30%WT. |
|
| CB1600 |
C. elegans |
tra-2(f70) II. Show Description
Transforms XX to males. Variable expression. Masculinized self-fertile hermaphrodite. tra-2(f70) was crossed into the N2 background to construct a dpy-10 tra-2 unc-4 triple mutant, then crossed to remove the flanking dpy and unc (Jonathan Hodgkin). |
|
| CB1918 |
C. elegans |
lon-1(e185) unc-32(e189) III. Show Description
Long. Unc. Linked closely. |
|
| CB1951 |
C. elegans |
unc-42(e270) sma-1(e30) V. Show Description
Small. Unc. Linked closely. |
|
| CB2195 |
C. elegans |
dpy-19(e1259) unc-32(e189) III. Show Description
Dpy. Coiler Unc. Closely linked. Doesn't grow at 25C. |
|
| CB2196 |
C. elegans |
daf-4(e1364) unc-32(e189) III. Show Description
Temperature sensitive dauer constitutive. Unc. Closely linked. |
|
| CB2206 |
C. elegans |
lon-1(e185) daf-4(e1364) unc-32(e189) III. Show Description
Temperature sensitive dauer constitutive. Long. Unc. Linked closely. |
|
| CB2222 |
C. elegans |
unc-42(e270) unc-41(e268) V. Show Description
Growth slow. Severe Unc. Linked closely. |
|
| CB2823 |
C. elegans |
tra-1(e1488) III; eDp6 (III;f). Show Description
Balanced well. Animals with the duplication are WT. Animals which have lost the duplication have a hermaphrodite gonad and intestine (they are self-fertile); the rest of the body is male. |
|
| CB2829 |
C. elegans |
tra-1(e1076) III; eDp6 (III;f). Show Description
Balanced well. Animals with the duplication are WT. Animals which have lost the duplication have a hermaphrodite gonad and intestine (they are self-fertile); the rest of the body is male. |
|
| CB3191 |
C. elegans |
C. elegans wild isolate. Show Description
Caenorhabditis elegans wild isolate. Apparently identical to N2. Isolated by Carl Johnson in June 1973 in a garden in Altadena, CA. Sample obtained from laboratory of R.E. Russell in October 1980. Sent to CGC in Jan. 1997. Reference WBG 10(2) 140-141. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| CB3234 |
C. elegans |
him-13(e1742) I. Show Description
Selfed hermaphrodites produce 5% males and 2% XXX hermaphrodites (percent of viable progeny), and 30% unhatched eggs (percent of total progeny). |
|
| CB4015 |
C. elegans |
fem-3(e1999) IV. Show Description
Weakest known fem-3 mutation. Viable non-temperature-sensitive self-fertile XX hermaphrodites. e1999 XO males are slightly feminized, sometimes male-fertile. Reference: Hodgkin (1986) PMID: 3770465. |
|
| CB4053 |
C. elegans |
egl-26(e1952) II; tra-3(e1767) IV. Show Description
Self-fertile intersexual XX animals. Tra-3 masculinized phenotype suppressed by egl-26 mutation. Reference: Hodgkin (1986) PMID: 3770465. |
|
| CB4389 |
C. elegans |
tra-2(e1209) II; smg-3(ma117) IV. Show Description
Poorly growing, low self-fertility masculinized XX hermaphrodites. Weak allele of tra-2, partly suppressed to self-fertility by smg (NMD) mutation; permits efficient selection of new feminizing mutations. References: Spence et al. (1990) PMID: 2317869. Zarkower et al. (1994) PMID: 7520378. |
|
| CB4419 |
C. elegans |
tra-3(e2333) IV. Show Description
ZZ21 lev-1(x21) tra-3(e2333) isolated by Jim Lewis as EMS-induced levamisole resistant derivative of N2. Found to carry a cryptic tra-3 allele by Jonathan Hodgkin. XX animals are viable hermaphrodites which produce 500 rather than 330 self-progeny; occasionally Egl; no other signs of masculinization. |
|
| CB4559 |
C. elegans |
smg-2(e2008) I; tra-1(e1732) III. Show Description
Grows poorly, best at 20C. Self-fertile intersexual XX hermaphrodite due to partial suppression of weak tra-1 allele by smg-2(NMD). References: Zarkower et al. (1994) PMID: 7520378. Hodgkin (1987) PMID:3428597. |
|
| CB4890 |
C. elegans |
smg-2(e2008) I; tra-1(e1488) III. Show Description
Intersexual self-fertile XX hermaphrodites with Smg (protruding vulva) phenotype. Grows poorly, does best at 20C. Class B1 allele of tra-1 combined with smg-2(NMD), useful for selection of modifiers. Reference: Zarkower et al. (1994) PMID: 7520378 |
|
| CB4905 |
C. elegans |
tra-2(e1403) II. Show Description
Weak Tra-2 allele, homozygous self-fertile XX. Slightly masculinized hermaphrodite, adults lack tail spike. Reference: Hodgkin & Barnes (1991) PMID: 1684664. |
|
| CB4951 |
C. elegans |
spe-12(hc76) I; him-8(e1489) IV. Show Description
Male/female strain which must be maintained by mating. spe-12(hc76) prevents self-fertility in hermaphrodites but does not impair spermatogenesis in males. Presence of him-8(e1489) increases male frequency. |
|
| CB4952 |
C. elegans |
tra-2(e2541) II. Show Description
Hypomorphic allele. Homozygous XX animals are masculinized; have hermaphrodite gonad, abnormal male non-gonadal anatomy; self-fertile. |
|
| CB5200 |
C. elegans |
smg-2(e2008) I; tra-1(e2272) III. Show Description
Self-fertile hermaprodite or female. Protruding vulva. tra-1(e2272) XX homozygotes are sterile with abnormal gonads; e2272 mutation is partly suppressed by NMD (smg-2(e2008)), hence double mutants are fertile. Reference: Zarkower et al. (1994) PMID: 7520378. |
|
| CB5265 |
C. elegans |
sup-1(e995e2636) III; unc-17(e245) IV; xol-1(y9) X. Show Description
Severely uncoordinated coiler, slow growing. Useful strain for selecting non-Sup-1 suppressors of unc-17(e245). Reference: Mathews et al. (2012) PMID: 23051648. |
|
| CER162 |
C. elegans |
unc-119(ed3) III; cerIs7. Show Description
cerIs7 [lsm-1::GFP(fosmid) + unc-119(+)]. cerIs7 rescues all the temperature-sensitive phenotypes of lsm-1(tm3585). Reporter contains full-length lsm-1 tagged with GFP. GFP was inserted into a fosmid containing lsm-1. GFP is expressed diffusely in the cytoplasm of somatic cells. Under heat shock conditions, GFP accumulates forming cytoplasmic foci. Reference: Cornes E, et al. RNA. 2015 Sep;21(9):1544-53. |
|
| CER348 |
C. elegans |
trxr-1(cer35[Sec666C]) IV. Show Description
Missense mutation selenocysteine to cysteine. Resistant to cisplatin exposure. Primers to genotype this missense mutation and other silent mutations: [Common Fw: GGCTTCCACATTCTCACTCC] [RV wildtype: CTTAACCTCAGCAACCAGAA] [RV Sec to Cys: CTTAACCGCAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6). |
|
| CER374 |
C. elegans |
trxr-1(cer55[Sec666X]) IV. Show Description
Missense mutation engineered by CRISPR removes a selenocysteine to place a stop codon. Resistance to cisplatin exposure. Primers to genotype the cer55 and other silent mutations: [Common Fw: #1224 GGCTTCCACATTCTCACTCC] [RV wildtype: #1414 cTTAACCTCAGCAACCAGAA] [RV Sec to STOP: #1421 CTTAACCTTAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6). |
|
| CF4639 |
C. elegans |
glh-1(sam140[glh-1::T2A::wrmScarlet(1-10)]) I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
fib-1(mu498[wrmScarlet11::fib-1]) generated via CRISPR/Cas9 insertion into parental strain DUP237; transgene contains a linker between wrmScarlet11 and fib-1. Endogenous fib-1 detectable in the germline. T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249. Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628. |
|
| CFJ302 |
C. elegans |
unc-119(kst33) III. Show Description
Maintain at 15C. Temperature-sensitive unc-119 allele. Wild-type at 15C, intermediate Unc and Egl at 20C, and fully penetrant Unc and Egl at 25C. For use in transgenesis, maintain the strain at lower temperatures for increased brood size and easier injection, then transfer animals to 25C to select for transgenic animals based on Unc rescue. Molecular characterization shows a complex allele with a 210 bp duplication from a nearby exon-intron junction, which introduces 12 amino acids and a putative splice donor at a consensus splice acceptor site. The phenotype is most likely caused by temperature-sensitive splicing defects based on RT-PCR. Reference: Aljohani M, et al. Arrayed oligo libraries: genome-wide DNA- and RNP-based platforms for templated and non-templated CRISPR-Cas9 editing in C. elegans. (Submitted) |
|
| CGC1 |
C. elegans |
C. elegans wild isolate. Show Description
CGC1 (formerly known as PD1074) is intended to be used as a wild-type reference strain with the closely matched genome assembly of Yoshimura, et al. (Genome Res. 2019 Jun;29(6):1009-1022) available on Wormbase as VC2010-1.0. (ENA study accession PRJEB28388; assembly accession GCA_900538205). CGC1 is a defined and recently cloned population of animals derived from the original "Bristol" variant of C. elegans originally obtained by Brenner from E. Dougherty with no known history of mutagenesis. Brenner's original population, called N2, was used as the basis for the vast majority of laboratory strains in use currently. No early frozen stock of the unmutagenized N2 population currently exists, but later stocks were available from several laboratories. CGC1 is a clonal population founded by picking a single worm of one such stock, VC3510. VC3510 in turn derives from a subpopulation of N2 described in the literature as VC2010. We note that CGC1 is expected to be largely similar to most lab N2 strains, but that as a clonal isolate derived from N2, there will be some loci that will vary compared to any other particular N2 isolate. One such example is a partial deletion of the alh-2 locus in CGC1. Additional loci that were found to vary between the prior N2 reference genome (WormBase release WS264) and the VC2010-1.0 assembly are detailed in supplemental table 8 in Yoshimura, et al, (2019). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| CGC128 |
C. elegans |
+/hT2 [umnIs15] I; dcr-1(pk1351)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, dcr-1 homozygotes (protruding vulva, sterile/egl, rupture at vulva), lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Pvul. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived from parental strains CGC26 and NL687. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] |
|
| CGC26 |
C. elegans |
dpy-5(e61)/hT2 [umnIs15] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] |
|
| CGC52 |
C. elegans |
dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs42] III. Show Description
umnIs42 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate2+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] |
|
| CGC58 |
C. elegans |
C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| CGC59 |
C.elegans |
gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| CGC61 |
C. elegans |
F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| CGC72 |
C. elegans |
npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| CGC73 |
C. elegans |
npr-28(umn6[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| CGC78 |
C. elegans |
C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| CGC81 |
C. elegans |
C09F12.3(umn9[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| CGC86 |
C. elegans |
dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs67] III. Show Description
umnIs67 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] |
|
| CGC92 |
C.elegans |
dpy-5(e61)/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] |
|
| CL2355 |
C. elegans |
smg-1(cc546) dvIs50 I. Show Description
dvIs50 [pCL45 (snb-1::Abeta 1-42::3' UTR(long) + mtl-2::GFP] I. Maintain at 16C. Pan-neuronal expresion of human Abeta peptide. Constitutive intestinal expression of GFP from marker transgene. Strain shows deficits in chemotaxis, associative learning, and thrashing in liquid. Strain also has incomplete sterility due to germline proliferation defects and embryonic lethality. Maintain at 16 C to reduce selection against transgene, although this does not alter the partial sterility. Reference: Wu Y., et al. J Neurosci. 2006 Dec 13;26(50):13102-13. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] |
|
| CL4176 |
C. elegans |
smg-1(cc546) I; dvIs27 X. Show Description
dvIs27 [myo-3p::Abeta(1-42)::let-851 3'UTR) + rol-6(su1006)] X. Rollers. Temperature sensitive: needs to be propagated at 15C. Upshift larval animals to check that the worms get paralyzed and give offspring that arrest as eggs/early larvae. This strain produces low levels of beta amyloid peptide even when grown at low temperature, and therefore there is always some selection for loss of transgene copies. It is recommended to maintain growing stock plates at 15-16 degrees C by transferring small numbers of animals each generation rather than by "chunking", which increases the effective population size and therefore the chance of a relatively rare transgene loss, and then this revertant taking over the population. The strain should also be frozen shortly after being received. This strain can only be sent to academic users and not to commercial organizations. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] |
|
| CL6049 |
C. elegans |
dvIs62 X. Show Description
dvIs62 [snb-1p::hTDP-43/3' long UTR + mtl-2p::GFP] X. Temperature-sensitive. Maintain at 16 to minimize selection against transgene. Uncoordinated from hatching; phenotype is stronger at higher temperatures. Intestinal GFP expression. Reference: Ash PE, et al. Hum Mol Genet. 2010 Aug 15;19(16):3206-18. |
|
| CP36 |
C. briggsae |
Cbr-fem-2(nm27) III. Show Description
XX animals have no obvious phenotype: self-fertile with normal brood size. XO animals are self-fertile hermaphrodites with low brood size and some somatic gonad defects. Cbr-fem-2/+ XO animals show late-onset germline feminization. AF16 was the parental strain. |
|
| CP87 |
C. briggsae |
Cbr-fem-3(nm63) IV. Show Description
XO are self-fertile hermaphrodites with low brood size and some somatic gonad defects. XX animals have normal brood size. |
|
| CP89 |
C. briggsae |
Cbr-fem-2(nm27) III; Cbr-fem-3(nm63) IV. Show Description
XX are self-fertile hermaphrodites. |
|
| CX5000 |
C. elegans |
slt-1(eh15) X. Show Description
slt-1 mutants have no dissecting-scope phenotype. They have a 40% penetrant defect in the ventral guidance of the AVM neuron scored with mec-4::GFP, a mild defect in CAN cell migration that is enhanced by a ceh-23::GFP transgene, and a mild defect in midline crossing by PVQ neurons scorable with sra-6::GFP. slt-1(eh15) is a complex rearrangement that duplicates the endogenous slt-1 gene, but disrupts both duplicated copies. The two copies are linked on X but the exact distance between them is not known. The duplication probably extends >13 kb based on Southern blotting. Deletion breakpoints for the first copy of slt-1 are as follows: nucleotides 26219 to 28163 and 28197 to 28294 in cosmid C26G2 are deleted. The second copy of slt-1 contains the following structure: nucleotides 28197 to 28294 in C26G2 are deleted, followed by a duplication of nucleotides 28300 to 28396 in C26G2 that begins 5 nucleotides after the deletion. Both copies of slt-1 are mutant, as confirmed by both DNA sequence and RT-PCR analysis of slt-1 mRNA. Scoring for homozygosity of the slt-1 allele by PCR is difficult because of the two copies of the gene and because the small deletion and the small duplication of the second copy of slt-1 are the same size. The mutant can be followed indirectly by X linkage (very closely linked to unc-3). It may be possible to make a specific primer within the duplicated region that detects a unique band in the slt-1 mutant. |
|
| CYA6 |
C. elegans |
rexEx4. Show Description
rexEx4 [myo-2p::mCherry::P2A::Flag::UltraID::unc-54 3'UTR]. Pick mCherry+ to maintain. Mosaic expression of red fluorescence (mCherry) in pharynx. P2A is the self-cleaving peptide sequence. |
|