More Fields
Strain Species Genotype
BC3590 C. elegans dpy-18(e364)/eT1 III; unc-46(e177) let-433(s950)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUnc sterile adults and dead eggs. Maintain by picking WT.
PS9500 C. elegans ufd-3(sy1798) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ufd-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into very 1st exon of the gene. Left flanking sequence: CAATTTCCCATGTTATTGAAGCCCACAAATCCGACA. Right flanking sequence: CAAAGGCTTTGGCAGTTACTCAAGGCGGATGCTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGCCCACAAATCCGACACAA Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS9502 C. elegans srsx-40(sy1800) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srsx-40. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTATTTTGACAATCGACAGAATAATTGCCACGT right flanking sequence: GTACACCTATTCAATACAAGAATTTGAAACATTGTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTATTGAATAGGTGTACACG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9504 C. elegans him-5(e1490) V; str-74(sy1802) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of str-74 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGGAATATTGTTTTCGGGAATAGAAATCCTTGC right flanking sequence: CAGACCATTCGCTCATAATTATAACAACAGTTTGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATGAGCGAATGGTCTGGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9506 C. elegans col-84(sy1804) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-84. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gatttttaaagcgaatttttctagCAAGAAACCGACG right flanking sequence: CAATGTGGAAGGATTTGGTTCAAATTGGCACCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAAATCCTTCCACATTGCGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9508 C. elegans kvs-2(sy1806) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kvs-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAATTGGTGAATCAAGGAGCACGACGATCACACATGA right flanking sequence: TTCCGgtttgattttcattgaattcgtgggaac inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGACGATCACACATGATTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616