More Fields
Strain Species Genotype
BC2650 C. elegans dpy-18(e364)/eT1 III; dpy-11(e224) rol-3(s833)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, dead eggs, and DpyRol. Maintain by picking WT.
PS8330 C. elegans frpr-5(sy1274) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-5. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. left flanking sequence: gATGAAAATGCAGATCTCCTCGCGTACACCAAAA right flanking sequence: CGTTGGCTTGCCGAGGTGAACATTGTAGATGTTG Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACCTCGGCAAGCCAACGTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8334 C. elegans frpr-11(sy1278) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-11. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAACTGCTTCCTCATCTTTAAACTCACACAGTTATG right flanking sequence: ATATGGTTGAAGTGTTTGCTATGATTATGTTGCC Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACTCACACAGTTATGATA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616