More Fields
Strain Species Genotype
BC2908 C. elegans dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-423(s818)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.
PS8181 C. elegans pals-16(sy1207) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAATCATTGACAAATTGCAGAACATCAACACCTT Right flanking sequence: Ggtaggttgaagaagttattattggaatttgaaat inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAGAACATCAACACCTTGGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8185 C. elegans H39E23.3(sy1210) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of H39E23.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCGGTCACTGTTCAAGGATTCCCTACAAAAGATC Right flanking sequence: GTGAGGCCAGAGAGACTGAACCAGTGAAACTGCCAAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTCCCTACAAAAGATCGTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8189 C. elegans nlp-76(sy1214) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-76; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagTGTTCATCGCAATCTGCGTGCTCTCCCAAAA Right flanking sequence: CGCTATGGCCCTCCGTGGTGCACTATTCCGTTCTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CACGGAGGGCCATAGCGTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616