More Fields
Strain Species Genotype
BC124 C. elegans dpy-14(e188) unc-13(e51) unc-37(s80)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLet. The DpyUncLet larvae are abnormal. Pick WT to maintain.
CGC139 C. elegans unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270) umnIs80] V. Show Description
umnIs80 [myo-2p::mKate2 + NeoR, I: 6284001] I. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
DS80 C. elegans mat-1(ax144) I; him-8(e1489) IV. Show Description
Temperature sensitive. Maintain at 15C.
DY164 C. elegans unc-32(e189) syIs80 III; him-8(e1489) IV. Show Description
syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. Animals are Unc. GFP fluorescence is observed in vulval cells, uterine pi cells and VC neurons.
LE3992 C. elegans rdvIs1 III; lqIs80 IV. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. lqIs80 [SCMp::GFP::caax] IV.
NP898 C. elegans cdIs80. Show Description
cdIs80 [pcc1::PLCd::GFP + rol-6(su1006)]. Rollers.
NY2080 C. elegans ynIs80. Show Description
ynIs80 [flp-21p::GFP].
PS3808 C. elegans unc-119(ed4) syIs80 III. Show Description
syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. GFP expression in developing vulval cells, VCs and uterine pi lineage cells. Received new stock 9/2003. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Received new strain from Bhagwati Gupta on April 7, 2008.
PS80 C. elegans let-23(sy1) unc-4(e120) II. Show Description
Unc. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
RW10868 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; wgIs80. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs80 [eor-1::TGF(9G1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
SYS80 C. elegans ujIs113 II; Y75B8A.6(dev31([gfp::Y75B8A.6]) III. Show Description
GFP knockin at N-terminus of Y75B8A.6 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
GS807 C. elegans unc-32(e189) lin-12(n676n930) III; sqt-3(sc8) sel-1(e1948) V. Show Description
RollerUnc. At 25C e1948 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. e1948 recessively suppresses vulval lineage defects and proximal mitosis. sc8 previously called rol-4(sc8). See also WBPaper00002448. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JPS809 C. elegans vxSi808 X; vxIs591. Show Description
vxSi808 [rab-3p::APP::mCherry::unc-54 3'UTR] X. vxIs591 [tph-1p::GFP::unc-54 3'UTR]. Single-copy insertion of human APP transgene tagged with mCherry expressed throughout the nervous system, visible along ventral nerve cord, head, tail, and other neurons. GFP expression in all serotonergic neurons. References: Yi B, et al. 2017 J Neurochem 140(4): 561-575. PMID: 27926996. Mondal et al. 2018 ACS Chem Neurosci. DOI: 10.1021/acschemneuro.7b00428 PMID: 29426225
JS803 C. elegans unc-119(ed3) III; vwIs346. Show Description
vwIs346 [pie-1p::LAP::CDC-48.2 + unc-119(+)].
NM2686 C. elegans elks-1(js805) IV. Show Description
Superficially wild-type. Maintain under normal conditions. Reference: Deke SL, et al., J Neurosci. 2005 Jun 22;25(25):5975-83.
OP800 C. elegans unc-119(tm4063) III; wgIs800. Show Description
wgIs800 [gei-3::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OP801 C. elegans unc-119(tm4063) III; wgIs801. Show Description
wgIs801 [B0336.3::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OP802 C. elegans unc-119(tm4063) III; wgIs802. Show Description
wgIs802 [scrt-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OP808 C. elegans unc-119 (tm4063) III; wgIs808. Show Description
wgIs808 [ceh-58::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44.
OP809 C. elegans unc-119 (tm4063) III; wgIs809. Show Description
wgIs809 [ets-5::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44.
PS8008 C. elegans ZC376.2(sy1170) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZC376.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCCTGGGACGGAGTTTTGGAGGCGAAGGAGTATA Right flanking sequence: AAGCGGCTTGTATGAGTGATCAGAAgtaagagata inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGGCGAAGGAGTATAAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8010 C. elegans cpn-4(sy1172) I. Show Description
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of cpn-4 (F49D11.8). Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGCAAGCAAGTTCAATGATGTTGAAGCTGGATACT; right flanking sequence: TGTTGGAATGGATTCGGgtaagatttgggtagatt; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).
PS8012 C. elegans Y55F3BL.4(sy1174) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55F3BL.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAGACGACGGATTCACCCTGGTCACTGGTAGAAA Right flanking sequence: AGCCGGAAAACAGTCGGCGAAATTTgtcagttttc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGGTCACTGGTAGAAAAGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8027 C. elegans nlp-67(sy1176) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-67; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTCACTTTCTTGCTCGTCACTCTTTTTGCCCTCGC Right flanking sequence: CAATGTCATGCAAGCACAGCGTTACGATCGAGCC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTGCTTGCATGACATTGGCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8029 C. elegans R173.3(sy1178) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of R173.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTCGAATTGAGGGTCAACTCTGGAGCAATCCG Right flanking sequence: taagtacatgattttttattc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTCTTACCAGTCGCTCTCCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8031 C. elegans cest-1.1(sy1180) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of cest-1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGGAGACCTTCGATATCGAAAACCCCGTCCACCG Right flanking sequence: AAATCATGGGAAGGAGTTTTGGTAACAAATGAATA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ACTCCTTCCCATGATTTCGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8033 C. elegans F13H6.3(sy1182) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of F13H6.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGGGTACCTCGGGATCCCGTATGCGAAACCACCA Right flanking sequence: GTCGGCGAACTTCGATTTAAGAAGCCAGTAACCGTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AATCGAAGTTCGCCGACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8083 C. elegans syEx1649. Show Description
syEx1649 [nhr-246p::GFP + unc-122p::RFP]. Pick RFP+ (coelomocytes) to maintain. Dauer decision marker that indicates commitment to dauer formation in intestine and hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS9391 C. briggsae syIs802 X. Show Description
syIs802[Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS9392 C. briggsae syIs803 II. Show Description
syIs803 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS9393 C. briggsae syIs804 X. Show Description
syIs804 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS9396 C. briggsae syIs807 IV. Show Description
syIs807 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.