Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-129. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ccgtctggcaccaaatgATGACTGTTGTCCCACA right flanking sequence: AGGAGGCAAGCAACGTCAAGTCTACGAGTCCCTGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGACTGTTGTCCCACAAGG Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-137. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATCGCAATTTCCACGATTGCAACTCTGACCGCTA right flanking sequence: TCTTGGCAATTCCAATGTTGTACAATTACATGCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGCAACTCTGACCGCTATCT Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ggaatacttactaatttaaaatttttagCCTATA right flanking sequence: CTCTAACGTTCATCCTTTCTTGTCATTCATCCTATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGGATGAACGTTAGAGTAT Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-47. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCATTTTTGTACTTGCAATTTTTATATTTCCAATT right flanking sequence: GCTTCAATTTCGTGTCCAAGTGGCTTTACACTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGACACGAAATTGAAGCAAT Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-139; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTTACCGATTCATTGCCTACTCGGCAGTTACAC Right flanking sequence: TTTCGGTTGCTGCAGTTTTTGGGgtaagtttcagc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTACTCGGCAGTTACACTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-156; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCGAACACGTTCATCGCTGGACTCACCACTGT Right flanking sequence: ATCCGGTGTAGCGATTCTCGGATGTCTTTTGTTTTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTGGACTCACCACTGTATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

syIs696 [nlp-56p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for RMG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.

syIs700 [nlp-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for PVQ neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.

syIs704 [pdf-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + mbr-1p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for AIM neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.

syIs705 [gcy-32p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AQR, PQR, and URX neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.

syIs707 [osm-10p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR, srb-6p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] split cGAL driver for PHA and PHB neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.

syIs710 [srg-13p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for PHA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-7; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGCTCAGTTGTTTGATCCGAACAGTAACAGTA Right flanking sequence: CGCAGGCATTTCTTCGGAAACTTGCACATTTTCAAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCGAACAGTAACAGTACGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-8; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATATTCATCCGTACGTCTCTGTGATTCTCTGTCT Right flanking sequence: TGCAGgttggttattatgaagtgatcgcacatgttg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCTGTGATTCTCTGTCTTGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACAACGGTATTCGAGACGTTTCTCCTCGAATAT Right flanking sequence: GGGAGGATAATTCACCCGCCGATGGTCCTACTTTTATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGTTTCTCCTCGAATATGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAGGAACACTGTTCGACCCGCAGGATCCCGCAG Right flanking sequence: TTTCTGGCCTCATCGATGCTCTCGAGCAATTTCAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATCGATGAGGCCAGAAACTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-9; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATATTTTAGCCAATATCCGGAAGCCAATAGTG Right flanking sequence: ACGAGGCAAAAGATTTGTTTATTACTTCATTGATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCGGAAGCCAATAGTGACG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-10; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCAGTGGCCAGATCCAGAAACTGGAGATGCTAAGG Right flanking sequence: ACTTGGTTATTTCTCAATTTATTAATACAGTTGTAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AACTGGAGATGCTAAGGACT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-42; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAATGGAAATCCGAAGGCTCCGCTGCAAGTGCA Right flanking sequence: CTTTGGTTTTTATGTGGAGAGCTTGGGAAATTTCAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCCGCTGCAAGTGCACTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

syIs716 [klp-6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for IL2 neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-11; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTGAGGCTGCAATTAATAACGGAATTGTTTCCTTCA Right flanking sequence: TGGACGCATTAGTAAAgtaatttaaactttagc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTTTACTAATGCGTCCATGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-14; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGTTTATTGCTGTTAGTGATTTCGGATGTGCAGT Right flanking sequence: TACTGGTTTGATGCAATTATTTATAAGAAATTATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GATTTCGGATGTGCAGTTAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of gnrr-1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCAATGATTCTGTTCTATCAATTGTCTTCACAT Right flanking sequence: ATTTGGCTTTATTTATTCTGGCATTTGTTGGAAATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATCAATTGTCTTCACATATT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-5; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctttgaaaaaaatggttgcagGGTCTACACAGTATTG Right flanking sequence: CATCGGTATTTATGTCTTTTTGTGTGTTTTTTCG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGGTCTACACAGTATTGCAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-12; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGGCCGTTTCACTACTATATATTCACTTCCTTAG Right flanking sequence: TTGTTTTGCATTTTTTGCAAATATTATGATTGTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAAAAAATGCAAAACAACTA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-13; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACTGTGCCATATCCGGAGCCGGGCACCGATGAA Right flanking sequence: GTTGGGAATAGCACGATTCCATGGTTGATTACTAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGCCGGGCACCGATGAAGTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-15; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: AAAAAACATGTCAGAAAATAAAAATCGCGGAGATA Right flanking sequence: TTTCGGATTGTCAACAAAATTTGCTCGATTCAAATC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAAAAATCGCGGAGATATTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTTAAGTTTCTTTGCAAATGCTCTTATCGCTATAG Right flanking sequence: TTCTGGCAAACAAGGTTATGAGGATTTCTGGAAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGCTCTTATCGCTATAGTTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-21. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACAAAAATCTTCAAAACGACTAGATCTTCAAGGC right flanking sequence: ATCCGGGCTCTCGCTATTCTAGTTGTTCTTGGCTTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACTAGATCTTCAAGGCATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of sprr-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAGTTTATTGCGGCAATGCGCATGCAGAGCCAAAT Right flanking sequence: AGCTCAGCAGTTCAACAACTTGCAGAAGCATGTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGTTGAACTGCTGAGCTATT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-6. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gtaatttttattttaaaaaaacacgtttcagAACC right flanking sequence: CCATGGAAATGGAATATTTCCGCCCATTCTTTATTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACACGTTTCAGAACCCCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-30; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtaattttgaaacttgctgaaattttcagATTCCGCCG Right flanking sequence: AATCCTGCCACTCTACTATCTCCTCATCTTCTTAA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGTAGAGTGGCAGGATTCGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATGAAAATATGAAACGTTGGACGAAAAACCCGGAA Right flanking sequence: GCAAGgtaaaaagggaataactcaatataattc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGACGAAAAACCCGGAAGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-12. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTTTCCAACTTCTAATGTTCAAAGTTACACCTTGA right flanking sequence: ATGAAGTGTTTTCAATGGTTATGCTACCAATTATT inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATTGAAAACACTTCATTCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTCGTCAAATTGTTCTACAATTGCAACACCCAAC Right flanking sequence: AGCAAAGTCAGATTTCGGTATCATGAGAAACGATATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGAAATCTGACTTTGCTGTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-4 ; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTCAATTGTTTTTTATATTATTCTGGGACTGACA Right flanking sequence: TCGTGGAAAAAGgtgagaatagcaagatttattc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTATTCTGGGACTGACATCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-5; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAGAGCACAAGCACATCGGTAGCAATGTCCACAT Right flanking sequence: CAGACGGGTTCAGTAGCCATGACGATATTTCACAATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTACTGAACCCGTCTGATG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-6; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGAATCTACATCCAGCGATGTTACTGTCCTAAC Right flanking sequence: AGACTATAGCAGTACTATTCCAGAAAATCTTCCG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAGTACTGCTATAGTCTGTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-7; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGTCAGTGTTGCGAGTACATCAACAGCCCCACTT Right flanking sequence: GATCATGTCACAGTTCCAAATGCTCTTCCATCAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAACTGTGACATGATCAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-8; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATCACCCACACATCATCATGAACTCTACCGACGA Right flanking sequence: CCTTGGATTCATGAGCCAAGAGCCACgtaagtctag inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATGAACTCTACCGACGACCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of msp-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTTGGACCCAAAGGAAGCTGTGCTTCTTGCCGTGT Right flanking sequence: CATGCGATGCCTTCGCCTTCGGACAGGAGGACAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGCGAAGGCATCGCATGACA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of flp-1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACTCTGCTCTACCAAGTAGGGTTATTACTCCTTGT Right flanking sequence: GGCAGCTACTTATAAGgtttctttcttgatttaat inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CCTTATAAGTAGCTGCCACA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

syIs802[Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs803 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs804 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs807 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs824 [15xUAS::Chrimson::tdTomato::let-858 3'UTR + myo-2p::GFP + 1kb DNA ladder (NEB)]. Red light-activated channelrhodopsin cGAL effector. [NOTE: due to an error in the information submitted to the CGC, this strain was previously described as carrying the array syIs803 with a ttx-3::RFP co-injection marker. The correct name for the array is syIs824 and it carries the myo-2p::GFP marker.]

syIs807 [pps-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASJ neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.

syIs812 [srj-26p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.

syIs815 [nlp-76p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.