More Fields
Strain Species Genotype
PS8642 C. elegans syIs672; syIs300. Show Description
syIs672 [gcy-8p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AFD neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8643 C. elegans syIs673; syIs300. Show Description
syIs673 [rig-5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for SAA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8648 C. elegans syIs678; syIs300. Show Description
syIs678 [flp-8p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for URX neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8650 C. elegans syIs680; syIs300. Show Description
syIs680 [gcy-5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASEL neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8653 C. elegans syIs683; syIs300. Show Description
syIs683 [gcy-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASE neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8660 C. elegans syIs690; syIs300 Show Description
syIs690 [tph-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR +pdf-1p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. [NOTE: Pick animals with RFP+ coelomocytes to maintain. Array appears to be lost or silenced in some animals.] Split cGAL driver for NSM neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8661 C. elegans syIs691; syIs300. Show Description
syIs691 [pdf-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + grl-2p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for MCM neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8674 C. elegans nlp-6(sy1449) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCGACTCGCCTTCGTTCTTCTCGTCTCGGCGTGCG right flanking sequence: TCATGGCAATGGCTGCTCCAAAACAAATGGTGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCTCGTCTCGGCGTGCGTCA Method Reference: G3 (Bethesda).
PS8676 C. elegans nlp-9(sy1451) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-9. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gaaaaaaagagagATGGATCGATTCGCCACCAGAT right flanking sequence: TTATCGCCCTTCTTCTGGTTCTTTTACAAATTGgtg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGAAGAAGGGCGATAAATC Method Reference: G3 (Bethesda).
PS8678 C. elegans nlp-13(sy1453) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-13. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGATCTCTTCAGATCTTCTGCATCATGTCCGCCA right flanking sequence: TCGCAATGGCATACAGTCAAGgtttgtgttgtgtc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACTGTATGCCATTGCGATGG Method Reference: G3 (Bethesda).
PS8680 C. elegans nlp-16(sy1455) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-16. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCTTTCCCCATTGGAAAAGACAATGAATCCGACG right flanking sequence: AGTCCGAAGTTGAAGTGGATACCACAACTGAAGCTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACTTCAACTTCGGACTCGT Method Reference: G3 (Bethesda).
PS8682 C. elegans nlp-19(sy1457) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-19. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ctctactgttgtatattcttcttcacaATGCTCTT right flanking sequence: ACGCGGTGTATGCCTTGCTCTTCTCATTCTAGTCAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTTCACAATGCTCTTACG Method Reference: G3 (Bethesda).
PS8687 C. elegans nlp-32(sy1459) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-32. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTACTTGTATTCTGTCTTATCGCATTGACCGCCT right flanking sequence: TGCCGGTTTTCTCTTTTCCAAATGGGCTAACTATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAAGAGAAAACCGGCAAGG Method Reference: G3 (Bethesda).
PS8689 C. elegans nlp-33(sy1461) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-33. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTTCTCTTTGCCATATTGGCTATCGTTGATGCCCA right flanking sequence: GTGGGGATgtaagttttcaataacttgtttctg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCTATCGTTGATGCCCAGTG Method Reference: G3 (Bethesda).
PS8691 C. elegans nlp-43(sy1463) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-43. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gctcggaagtATGTCGTTGGCTCAATCTACCTTCT right flanking sequence: ACCTTCTATTTGTTGCATTTTTGGCAGTTGTGATC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGCAACAAATAGAAGGTAGA Method Reference: G3 (Bethesda).
PS8693 C. elegans nlp-73(sy1465) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-73. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTGCTCATCGCGACCACTGTGCTCATCGCCGAGT right flanking sequence: CTCGTGTATTCTATAACCGATTCGACGGCGGGCTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATAGAATACACGAGACT Method Reference: G3 (Bethesda).
PS8695 C. elegans lgc-16(sy1467) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCACATTATTTTCATTTTCTGACATTTCCGCAT Right flanking sequence: TTTATCATGATCCAGGATTATATGgtaaagtttgg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCTGGATCATGATAAAATG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8697 C. elegans lgc-18(sy1469) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-18. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gtttttattcaaaatgttaattcttcattttgcagTTCCG right flanking sequence: GAATGGAACAATTTCTTGGAGAATCAAGTTAAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCATTTTGCAGTTCCGGAA Method Reference: G3 (Bethesda).
PS8702 C. elegans lgc-19(sy1472) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-19. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTATCGATTCTTTTTTCTTTGATCCAGAGTTATAC right flanking sequence: Ggtaggctattttggctttcaggctcaaaaaaggtg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGATCCAGAGTTATACGGT Method Reference: G3 (Bethesda).
PS8704 C. elegans lgc-1(sy1474) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cagTGGCAACCTACAACAAATTTCTCGCCGATCAA right flanking sequence: AAACGGCTTTGGGATGATTTATTCAAAGATTATGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATTTCTCGCCGATCAAAAA Method Reference: G3 (Bethesda).
PS8705 C. elegans lgc-24(sy1475) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-24. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTGTCACAATGGGAAACGGGAAAAAGCTTCACGG right flanking sequence: TTTTGgtgagttttatttttcatatgttgattattag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGGAAAAAGCTTCACGGTTT Method Reference: G3 (Bethesda).
PS8707 C. elegans lgc-21(sy1477) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-21. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGGCATTTGCTCTAGGCCAAGAGCAGAACCAAGC right flanking sequence: CGGTACCGCGGTTGCCGGGCCCCATATCGTCAACTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGGCAACCGCGGTACCGGCT Method Reference: G3 (Bethesda).
PS8708 C. elegans lgc-22(sy1478) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-22. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGCTTCTCATTGCCACGTCACTGGCCGCCACGTTA right flanking sequence: GCGTGGGCGGCGGGCACCGCCGGCGGCTGCGAGGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACTGGCCGCCACGTTAGCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8710 C. elegans lgc-25(sy1480) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-25. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cggtttcaagGGATTCTGGTAATCTGGCACCTGGA right flanking sequence: TAATCAAGTGTGTGGTCTTTCAAAAGAGCAACAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACCACACACTTGATTATCC Method Reference: G3 (Bethesda).
PS8711 C. elegans lgc-29(sy1481) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-29. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATATATTCGCTTTTATTTTATTTAATGGTCCCTCTC right flanking sequence: TGGAGCACTGATTCACAGAGCATGACGTCAGAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTGAATCAGTGCTCCAGAG Method Reference: G3 (Bethesda).
PS8713 C. elegans lgc-32(sy1483) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-32. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTGCACAAGTGATGAAGATGTGATTGCTGATCT right flanking sequence: CTTAGGAAGAAATTCACATTCTTCTGgtaacttattg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GATGTGATTGCTGATCTCTT Method Reference: G3 (Bethesda).
PS8721 C. elegans lgc-30(sy1486) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-30. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTTCATCCCGAAAAAACTAATAAAAAAGCCGCCG right flanking sequence: GCTATCGACGACACGGCGTTTCATCGGCGTCGAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCCGTGTCGTCGATAGCCGG Method Reference: G3 (Bethesda).
PS8723 C. elegans lgc-27(sy1488) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-27. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACACTTTCAGTTGCCGCTTATGATATCGATTGC right flanking sequence: AAATGGAAAAGCAATATTACAGgttggtgctcaaac inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTATGATATCGATTGCAAA Method Reference: G3 (Bethesda).
PS8725 C. elegans lgc-28(sy1490) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-28. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGCTTAAATATTCAACTGGAACCTTCTCCTGGCG right flanking sequence: AGATGGAGAAAAGATATGAAGCTGAGgtatgtttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAACCTTCTCCTGGCGAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8727 C. elegans lgc-37(sy1492) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-37. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATAATTCCCATCATTGCTCTAATCCATGGACATCATT right flanking sequence: CTCAGGCTGTCATAGACATGAAGAGACAACGgtaag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATCCATGGACATCATTCTC Method Reference: G3 (Bethesda).
PS8729 C. elegans lgc-41(sy1494) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-41. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCGGCCACCAACAGCAAATGCATCAGTACCACTC right flanking sequence: GGTGTCAAACTTGGAATGTATTTGGAGAGTCTCGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTCCAAGTTTGACACCGAG Method Reference: G3 (Bethesda).
PS8731 C. elegans lgc-43(sy1496) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-43. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cttctaattttcagAAGTTTTAACAACCGAAG right flanking sequence: CGTCAACTGATTCTTCTTCTCCAACATCGAGCATATTTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGAAGAATCAGTTGACGCTT Method Reference: G3 (Bethesda).
PS8741 C. elegans lgc-44(sy1500) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-44. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCTATTTCTCTTCTTTTTCTAATATTTCCACAT right flanking sequence: TCATCTAATCCTTCAAGCTCTAATTTTCTGGATATTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTGAAGGATTAGATGAATG Method Reference: G3 (Bethesda).
PS8742 C. elegans lgc-47(sy1501) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-47. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCCACATTGTTTCTGTTGCTCTATGCCACCCGGG right flanking sequence: AAACGGTCAATGCAATGACTGCCGAGATCAGCCC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATTGCATTGACCGTTTCCC Method Reference: G3 (Bethesda).
PS8743 C. elegans lgc-36(sy1502) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-36. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCGGAAGTTTTCGTATAAAACGAACTGTTCACCCT right flanking sequence: AAAAGgtaagtaaccatctaattcaactattttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACGAACTGTTCACCCTAAA Method Reference: G3 (Bethesda).
PS8745 C. elegans lgc-7(sy1504) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-7. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTCTTATTATCAATATTTCAATGAATACCATGT right flanking sequence: CTGTTCTAACACTAGATCCTGCTGAAGAAACCATC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATCTAGTGTTAGAACAGACA Method Reference: G3 (Bethesda).
PS8747 C. elegans lgc-48(sy1506) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-48. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cagcttcATGTTTTTTCATATTTTTTTGGGCCTACT right flanking sequence: GGTCGCTGTTTTGGGTGAAGAAGTTCATGAACTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACCCAAAACAGCGACCAGT Method Reference: G3 (Bethesda).
PS8749 C. elegans lgc-8(sy1508) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGGTATCAGAGCAGTTGAAGGATGTTCTTATGGAA right flanking sequence: Ggttggtattgatttagttcaccaaaaagagtttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGGATGTTCTTATGGAAGGT Method Reference: G3 (Bethesda).
PS8751 C. elegans otpl-1(sy1510) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGCACTGTTCTTAACCATTTTCTCACTGGTACTCG right flanking sequence: AGCTGGCTCACTTGCTCAATGATGAGGAATCCCGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTCTCACTGGTACTCGAGC Method Reference: G3 (Bethesda).
PS8769 C. elegans syIs695. Show Description
syIs695 [trx-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASJ neurons.
PS8779 C. elegans col-88(sy1512) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-88. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTATCCTTATCGGTACCCAGGTGATCCTCTCCACCG right flanking sequence: CTATCCTTGGCTCCCTGCTCTACGCCGGTGTCCTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGGGAGCCAAGGATAGCGG Method Reference: G3 (Bethesda).
PS8785 C. elegans ZK637.2(sy1518) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZK637.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGATGAGATGATTGACGATTTGGATAAGACCTATT right flanking sequence: TGAGGGATATGCAGAAGAGCATGTTTCAGTGCTCAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTCTGCATATCCCTCAAAT Method Reference: G3 (Bethesda).
PS8787 C. elegans col-81(sy1520) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-81. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: caaatatccctctcaattccagCATCGCCGCCGCTC right flanking sequence: TCATCGCTGTCATCGCCATCCCAGCCTTCTACAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGCGATGACAGCGATGAGAG Method Reference: G3 (Bethesda).
PS8789 C. elegans dmsr-1(sy1522) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCTATACATGCCTACTTATCAATATTTCTATGCGT right flanking sequence: GTTGGGTACAATCGCTAATTTCTGTAACATCGTCG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCAATATTTCTATGCGTGTT Method Reference: G3 (Bethesda).
PS8819 C. elegans col-120(sy1526) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-120. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTCTGGAATCATGTGCATTATTCTAATTCCTGGG right flanking sequence: CTTTACACATATCTACAATATATTCAAAGCTCTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTAGATATGTGTAAAGCCC Method Reference: G3 (Bethesda).
PS8821 C. elegans col-129(sy1528) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-129. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ccgtctggcaccaaatgATGACTGTTGTCCCACA right flanking sequence: AGGAGGCAAGCAACGTCAAGTCTACGAGTCCCTGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGACTGTTGTCCCACAAGG Method Reference: G3 (Bethesda).
PS8822 C. elegans col-137(sy1529) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-137. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATCGCAATTTCCACGATTGCAACTCTGACCGCTA right flanking sequence: TCTTGGCAATTCCAATGTTGTACAATTACATGCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGCAACTCTGACCGCTATCT Method Reference: G3 (Bethesda).
PS8823 C. elegans dmsr-6(sy1530) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ggaatacttactaatttaaaatttttagCCTATA right flanking sequence: CTCTAACGTTCATCCTTTCTTGTCATTCATCCTATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGGATGAACGTTAGAGTAT Method Reference: G3 (Bethesda).
PS8825 C. elegans clec-47(sy1532) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-47. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCATTTTTGTACTTGCAATTTTTATATTTCCAATT right flanking sequence: GCTTCAATTTCGTGTCCAAGTGGCTTTACACTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGACACGAAATTGAAGCAAT Method Reference: G3 (Bethesda).
PS8827 C. elegans col-139(sy1534) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-139; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTTACCGATTCATTGCCTACTCGGCAGTTACAC Right flanking sequence: TTTCGGTTGCTGCAGTTTTTGGGgtaagtttcagc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTACTCGGCAGTTACACTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616