More Fields
Strain Species Genotype
PS8430 C. elegans frpr-17(sy1302) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-17. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCAGTTAATCAGTCATGATATTATCGATCCAAGCT right flanking sequence: CAGTGGGATTTCAAAACTGTGAACCTTTGgtgag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTATCGATCCAAGCTCAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8432 C. elegans frpr-19(sy1304) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-19. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATGATTGGCTCAACAGAGGTGCCGTTGTTTGAGG right flanking sequence: AGGAGGATATGTGTACACCACTCAACATTTCTTGTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGTGCCGTTGTTTGAGGAGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8437 C. elegans syIs599. Show Description
syIs599 [nhr-246p::GFP + unc-122p::RFP]. Pick RFP+ (coelomocytes) to maintain. Dauer decision marker that indicates commitment to dauer formation in intestine and hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS8438 C. elegans syIs600. Show Description
syIs600 [col-183p::mCherry + odr-1p::GFP]. Dauer decision marker that indicates commitment to dauer formation in the hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS8441 C. elegans daf-2 (e1370) III; glo-1(sy1306) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of glo-1 in daf-2 (e1370) background. left flanking sequence: GATAAAATTTCCTACAAAGTGTTGGTAATTGGTGA; right flanking sequence: TCCAGGTGTCGGTAAAACATCTATTATTCGTCG. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTGTTGGTAATTGGTGATCC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8442 C. elegans npr-26(sy1307) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-26. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGCCCGATGGGATTTTGTATTGTCCAAATCACAC right flanking sequence: TGGTGGTCCCGTCTGGGTACGCAATGTCTATCCAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTGTCCAAATCACACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8444 C. elegans npr-21(sy1309) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-21. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGTGTATCCTACCTTTTTGTCTTTCTGGCCACTAT right flanking sequence: AATCGgtatgccaaggatctttgttcatattttta inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTCTTTCTGGCCACTATAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8450 C. elegans npr-27(sy1315) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-27. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gggtgtgccttcttgATGGAGGATTTTTCCTCGA right flanking sequence: ATTTCACGACAACTTCAATTCAGAATGATAGTTATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAAGTTGTCGTGAAATTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8453 C. elegans syIs534; syIs300 Show Description
syIs534 [flp-20p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + inx-11p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for gland cell. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8457 C. elegans syIs601. Show Description
syIs601 [ets-10p::GFP + ofm-1p::RFP]. Dauer decision marker that indicates commitment to dauer formation in neurons and intestine. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS8459 C. elegans syIs589. Show Description
syIs589 [15xUAS::wrmScarlet::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] mScarlet cGAL effector.
PS8461 C. elegans syIs591; syIs300. Show Description
syIs591 [srh-142p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ADF neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8462 C. elegans syIs592; syIs300. Show Description
syIs592 [srh-200p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ADL neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8463 C. elegans syIs593. Show Description
syIs593 [15xUAS::rlp-22HA::SL2::mCherry::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Tissue specific RNA-seq cGAL effector.
PS8466 C. elegans syIs605. Show Description
syIs605 [15xUAS::iC1-C2-TS::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Chloride-conducting channelrhodopsin cGAL effector.
PS8470 C. elegans syIs609. Show Description
syIs609 [15xUAS::nCRE::SL2::GFp::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Nucleolus-transport-enhanced Cre protein cGAL effector.
PS8476 C. elegans syIs615. Show Description
syIs615 [15xUAS::lmp-1::Venus::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Lysosomal associated membrane protein cGAL effector.
PS8484 C. elegans npr-31(sy1360) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-31. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ggaaaaactagttataaaaatgttcagATCCCTTA right flanking sequence: TGTCCAGAAGCTCCCCTTCAGATCGATTACGTGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGGGGAGCTTCTGGACATAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8486 C. elegans frpr-8(sy1362) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-8. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTTATTTCGCTTCTTAATAATTCTACACTGGTCA right flanking sequence: CTACGGATCAGCCAGGTTTTTCTGGAAGTACAAAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TAATTCTACACTGGTCACTA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8488 C. elegans frpr-2(sy1364) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTATGCGTGAGTGTGAATGCCTTCATGAGCCGATA right flanking sequence: GAGGGGTACGCGGGAGTTGCCAATCTGgtaagtatac inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACTCCCGCGTACCCCTCTAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8490 C. elegans frpr-16(sy1366) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-16. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cacattATGAATCGGTACGAGTTCTACGAGCTAAAA right flanking sequence: TCATGGATGTATTTACCTGTAATTTTCATTGGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGTTCTACGAGCTAAAATCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8496 C. elegans syIs627; syIs300. Show Description
syIs627 [str-2p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8498 C. elegans syIs629. Show Description
syIs629 [15xUAS::ChR2(C128s)::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Stable step function ChR2 variant cGAL effector.
PS8501 C. elegans syIs632. Show Description
syIs632 [15xUAS::myri::mCherry::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Cell membrane labeling fluorophore cGAL effector.
PS8504 C. elegans syIs635. Show Description
syIs635 [15xUAS::hChR2(C128s, D156A)::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Stabilized step function Opsins ChR2 variant cGAL effector.
PS8505 C. elegans syIs636. Show Description
syIs636 [15xUAS::miniSOG-103L::VAMP2::mCherry::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Reactive oxygen species production cGAL effector.
PS8508 C. elegans syIs639. Show Description
syIs639 [15xUAS::SwiChR::TS::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Step-Waveform Inhibitory Channelrhodopsin cGAL effector.
PS8509 C. elegans syIs640. Show Description
syIs640 [15xUAS::fem-3::mCherry::let-858 3'UTR + ttx-3p:RFP + 1kb DNA ladder (NEB)] cGAL effector to induce masculinization
PS8527 C. elegans oac-56(sy1372) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-56; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTTGTTTTACTATTTCACTTGAACCCTAACCTATT Right flanking sequence: TGTTAATGGATTTCTCGGTGTTGATATgtaagccc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctag. sgRNA : CGAGAAATCCATTAACAAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8529 C. elegans oac-57(sy1374) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-57; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGATATCATTTGCATTCAATTTTATTCTTCCATCT Right flanking sequence: AAAGTCTCTTTTAACAGTTTGCTTGCAAGAATATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGTTAAAAGAGACTTTAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8531 C. elegans oac-58(sy1376) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-58. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGATCTCATTCACATTCTATTCAATTCTCCCACT right flanking sequence: TGAAGTGGCTTTTAACAGTTTATTTGCAAGAATATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTTAAAAGCCACTTCAAGT Method Reference: G3 (Bethesda).
PS8536 C. elegans oac-51(sy1388) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-51. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gatttaataatttaggcATGGTAGTTTACACCGCT right flanking sequence: CTGTGGAACATTGAAGATCAAAATAAGCAATTTAAAAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGGTAGTTTACACCGCTCTG Method Reference: G3 (Bethesda).
PS8538 C. elegans oac-35(sy1390) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-35. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTTCTAATGTGCATGTTGCTCAAGCGTGCCGAGA right flanking sequence: CCCACCCATTTTTCACGTTGTTATGCACATTTTAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGTGAAAAATGGGTGGGTCT Method Reference: G3 (Bethesda).
PS8540 C. elegans dod-17(sy1392) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dod-17. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGTAATTGATGGTACGCCTGTATATTGGCCAGCT right flanking sequence: GCTTGGAACGAGACTCAGCCTGCTCCTCAGCTGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAGTCTCGTTCCAAGCAGC Method Reference: G3 (Bethesda).
PS8542 C. elegans acs-10(sy1394) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of acs-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTCTGGACTCATGTCGTATCCATGCAGCCGCCA right flanking sequence: ATAAGGACGCCATAGTTTTTgtgagtacggatttatc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTATGGCGTCCTTATTGG Method Reference: G3 (Bethesda).
PS8544 C. elegans clec-87(sy1396) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-87. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTTTTGCCTTCTCGTTGCTTTCATCCTTCCTGGG right flanking sequence: CTATTCCTCGTTCATGCAGCTCCGACTTCTTCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCATGAACGAGGAATAGCCC Method Reference: G3 (Bethesda).
PS8553 C. elegans syIs654. Show Description
syIs654 [15xUAS:VSFP-Butterfly-1-2::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Voltage-sensitive fluorescent protein cGAL effector.
PS8556 C. elegans syIs657. Show Description
syIs657 [15xUAS::act-2::Venus::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. cGAL effector for localiziation of actin filament and cell cortex
PS8558 C. elegans syIs695. Show Description
syIs659 [15xUAS::miniSOG-103L::mCherry::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Reactive oxygen species production cGAL effector.
PS8562 C. elegans syIs663; syIs300. Show Description
syIs663 [gcy-33p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for BAG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8565 C. elegans syIs666; syIs300. Show Description
syIs666 [str-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWB neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8578 C. elegans clec-88(sy1409) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-88. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: TTGGTATGTGCAGTTACTAACGATATTGAAGACGC right flanking sequence: TAGTGGAGAGACACCTGGAATTGTTTCTCAAATTAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACGATATTGAAGACGCTAG Method Reference: G3 (Bethesda).
PS8580 C. elegans oac-36(sy1411) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-36. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTAATGTGCATGTTGCTCAAGCGTGCCGAGACCAAGC right flanking sequence: CATTTTTCACAGTGGTATGCACATTTTACACGAGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACCACTGTGAAAAATGGCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8582 C. elegans oac-41(sy1413) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-41. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTAATTTTAATATTAGTACACGTTTTTCTACCGGAT right flanking sequence: TTCCTGTGGCAAAATAATAATAGATACTCTTTCGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTATTTTGCCACAGGAAATC Method Reference: G3 (Bethesda).
PS8584 C. elegans clec-91(sy1415) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-91. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGACCTACATCCTTATCATCGTCCCACTGATCAT right flanking sequence: CATTGGAGGCGGTGTCGTCGCTGACAACACAAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATCGTCCCACTGATCATCAT Method Reference: G3 (Bethesda).
PS8586 C. elegans npr-9(sy1417) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-9. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTCATCATTGCCTCTTCAGTAAATACACGTTCACC right flanking sequence: CATAGgtgtataattgaacttatgtatatgttttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTAAATACACGTTCACCCAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8630 C. elegans oac-44(sy1431) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-44. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTCTCGGATTCCACTTCTACCCAAACCAGTTTCC right flanking sequence: CAATGGATACCTCGGAGTGGATCAgttaggtttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACCCAAACCAGTTTCCCAA Method Reference: G3 (Bethesda).
PS8632 C. elegans oac-42(sy1433) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-42. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTTGACTTACAAGGAATTCGGGGTCTCGCCATTG right flanking sequence: CTGCAGTGCTTCTTTATCACTTTTATCCAAAACAA inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATAAAGAAGCACTGCAGCAA Method Reference: G3 (Bethesda).
PS8634 C. elegans col-135(sy1435) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-135. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCAGCGCTCGGGTATAATATTCGATATCCCTCCT right flanking sequence: ATGAACCAAATCGACAATATGGCCCATATTCGAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGTCGATTTGGTTCATAGG Method Reference: G3 (Bethesda).
PS8636 C. elegans ins-10(sy1437) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ins-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAAAAAACAATTCTTCTAATCTCATTCTTGCTCCTCGT right flanking sequence: AACATTGGCTCCCAGAACAAGTGCAGCTTTTCCATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTGGGAGCCAATGTTACG Method Reference: G3 (Bethesda).