ADS707 |
C. elegans |
unc-13(s69) I; aeaIs8; hpIs728. Show Description
aeaIs8 [ift-20p::GCaMP6s::3xNLS + lin-15(+)]. hpIs728 [gpc-1p::wCherry + lin-15(+)]. Unc. Nuclear-localized GCaMP6s expressed in ciliated sensory neurons. Cytoplasmic wCherry expression in a subset of neurons. Derived by crossing EG9631 (unc-13) hermaphrodites with ZM10104 (aeaIs8; hpIs728) heterozygous males. Reference: Lin A, et al. bioRxiv 2022.05.27.493772; doi: https://doi.org/10.1101/2022.05.27.493772.
|
|
AGK369 |
C. elegans |
zfp-1(ok554) III; armIs8. Show Description
armIs8 [zfp-1(short isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs8 transgene rescues the protruded vulva phenotype of zfp-1(ok554). Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
|
|
AV630 |
C. elegans |
meIs8 II. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Reference: Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.
|
|
AV828 |
C. elegans |
nbs-1(me102) meIs8/mIn1 [mIs14 dpy-10(e128)] II. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. References: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452. Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.
|
|
BC21 |
C. elegans |
unc-22(s8) IV. Show Description
Twitcher Unc. Recessive. Heterozygotes twitch in 1% Nicotine.
|
|
CA1369 |
C. elegans |
zhp-1(ie62[zhp-1::AID::3xFLAG]) I; meIs8 II; spo-11(ie59[spo-11::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
|
|
CA1377 |
C. elegans |
zhp-2(ie67[zhp-2::AID::3xFLAG]) I; meIs8 II; spo-11(ie60[spo-11::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
|
|
CA1421 |
C. elegans |
meIs8 dsb-2(ie58[dsb-2::AID::3xFLAG]) II; ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
|
|
CA1423 |
C. elegans |
meIs8 II; spo-11(ie59[spo-11::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
|
|
CGC19 |
C. elegans |
eT1 III; eT1 [umnIs8] V. Show Description
umnIs8 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.
|
|
DM8008 |
C. elegans |
raIs8. Show Description
raIs8 [unc-112::GFP + rol-6(su1006)]. Rollers. raIs8 produces a fully functional GFP-tagged UNC-112 protein that localizes to the dense bodies and M-line in muscle cells. Derived by integrating raEx16 in DM7016.
|
|
ERT54 |
C. elegans |
jyIs8 X. Show Description
jyIs8 [pals-5p::GFP + myo-2p::mCherry] X. GFP expression induced in the intestine after intracellular infection or proteasomal inhibition. Reference: Bakowski MA, et al. PLoS Pathog. 2014 Jun 19;10(6):e1004200.
|
|
HH35 |
C. elegans |
unc-9(hs8) X. Show Description
Cold sensitive Unc.
|
|
HS178 |
C. elegans |
psa-3(os8) X. Show Description
Superficially WT. Defects in asymmetric T cell division causes Psa (phasmid socket absent) phenotype.
|
|
JAR50 |
C. elegans |
rack-1(rns8[rack-1::mScarlet]] IV. Show Description
mScarlet tag inserted into endogenous rack-1 locus. Ubiquitous mScarlet expression.
|
|
KAB122 |
C. elegans |
louIs8. Show Description
louIs8 [ges-1p::nuc-1::mCherry::unc-54 3'UTR]. mCherry-tagged lysosomal nuclease NUC-1 expression can be used to monitor lysosomes in the gut. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.
|
|
LG344 |
C. elegans |
geIs8. Show Description
geIs8 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Reference: Nature (2007) 447(7144):545-9.
|
|
NR221 |
C. elegans |
rde-1(ne219) V; kzIs8. Show Description
kzIs8 [lin-26p::NLS::GFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
RG3486 |
C. elegans |
rps-15A(ve986[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Early larval arrest. Deletion of 598 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve986 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Other names: CELE_F53A3.3, uS8, rps-22. Left flanking Sequence: ATGAACGTCCTCGCCGATGCGCTCAACGCC; Right flanking sequence: CACGAGGAGGCCAGAAGAAAGCATTTGGGA. rps-22 crRNA A: ATCAACAACGCCGAGAAGCG; rps-22 crRNA B: ATCCATGATTCCGGCGGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
SA141 |
C. elegans |
unc-119(ed3) III; tjIs8. Show Description
tjIs8 [pie-1p::GFP::ebp-1 + unc-119(+)]. GFP::ebp-1 is found at the tips of growing microtubules in early embryos. pID3.01-ebp-1. Integration site unknown.
|
|
SJ4063 |
C. elegans |
zcIs8 X. Show Description
zcIs8 contains [abu-1::GFP].
|
|
UL8 |
C. elegans |
leIs8. Show Description
leIs8 [unc-5::lacZ + rol-6(su1006)]. Rollers. B-galactosidase expression was observed in the spermathecaeand the three rectal epithelial cells. Staining in the rectal area first observed in L1 larvae whilst expression in the spermathecae appeared as the structure formed in L4 larvae. Variable staining was also seen throughout the uterus. In the mature gonad staining appeared to be in two sets of two toroidal epithelial cells Ut-1 and Ut-2. Staining was also observed in the large H shpaed Use cell which attaches the uterus to the seam cells and the four epithelial cells Ut-1 and Ut-2. The Uv cells did not appear to stain. Individual worms often just showed one component of this expression. In males the expression was observed to be displayed in all or part of the procodeum. plasmid name: pUL#38E12. plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.
|
|
VL413 |
C. elegans |
unc-119(ed3) III; wwIs8. Show Description
wwIs8 [mir-35-41p::GFP + unc-119(+)]. Wild-type.
|
|
VS15 |
C. elegans |
hjIs8. Show Description
hjIs8 [ges-1p::GFP-PTS1]. GFP targeted to peroxisomes in intestinal cells.
|
|
VS8 |
C. elegans |
dhs-28(hj8) X. Show Description
Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
|
|
WUM120 |
C. elegans |
viro-9(vir16) IV; rde-1(ne219) V; jyIs8 X; virIs1. Show Description
jyIs8 [pals-5p::GFP + myo-2p::mCherry] X. virIs1 [pHIP::OrsayRNA1 + pHIP::OrsayRNA2 + myo-2p::YFP]. viro-9(vir16) is a missense mutation. Orsay virus replication defective. GFP expression induced in the intestine after intracellular infection or proteasomal inhibition.
|
|
WUM122 |
C. elegans |
viro-9(vir18) IV; rde-1(ne219) V; jyIs8 X; virIs1. Show Description
jyIs8 [pals-5p::GFP + myo-2p::mCherry] X. virIs1 [pHIP::OrsayRNA1 + pHIP::OrsayRNA2 + myo-2p::YFP]. viro-9(vir18) is a homozygous recessive missense mutation. Orsay virus replication defective. GFP expression induced in the intestine after intracellular infection or proteasomal inhibition.
|
|
WUM45 |
C. elegans |
rde-1(ne219) V; sid-3(vir9) X; jyIs8. Show Description
jyIs8 [pals-5p::GFP + myo-2p::mCherry]. Orsay virus infection defect. Reference: Jiang H, et al. mBio. 2017 Sep 5;8(5):e00940-17. doi: 10.1128/mBio.00940-17. PMID: 28874467.
|
|
WUM46 |
C. elegans |
viro-2(vir10) III; rde-1(ne219) V; jyIs8. Show Description
jyIs8 [pals-5p::GFP + myo-2p::mCherry]. Orsay virus infection defect. Reference: Jiang H, et al. mBio. 2017 Sep 5;8(5):e00940-17. doi: 10.1128/mBio.00940-17. PMID: 28874467.
|
|
WUM73 |
C. elegans |
drl-1(vir11) IV; rde-1(ne219) V; jyIs8. Show Description
jyIs8 [pals-5p::GFP + myo-2p::mCherry]. Orsay virus infection defect. Reference: Sandoval LE, et al. J Virol. 2019 Jan 17;93(3):e01400-18. doi: 10.1128/JVI.01400-18. PMID: 30429346.
|
|
WUM79 |
C. elegans |
hipr-1(vir13) III; rde-1(ne219) V; jyIs8. Show Description
jyIs8 [pals-5p::GFP + myo-2p::mCherry]. Orsay virus infection defect. Reference: Jiang H, et al. Proc Natl Acad Sci USA. 2020 Sep 8;117(36):22462-22472. doi: 10.1073/pnas.2006914117. PMID: 32839311.
|
|
WUM91 |
C. elegans |
rde-1(ne219) V; alg-1(vir14) X; jyIs8. Show Description
jyIs8 [pals-5p::GFP + myo-2p::mCherry]. Orsay virus infection defect. Reference: Cubillas C, et al. J Virol. 2023 Apr 27;97(4):e0006523. doi: 10.1128/jvi.00065-23. PMID: 37017532.
|
|
AY179 |
C. elegans |
ynIs87; acEx179. Show Description
ynIs78 [flp-8p::GFP]. acEx179 [flp-21p::ced-3 (p15)::nz + ncs-1p::cz::ced-3 (p17) + unc-122p::RFP]. RMG interneurons ablated in flp-21p::GFP background. GFP-labelled RMG neurons are missing in the neuronal ablated animals. Pick RFP+ animals to maintain. Reference: Filipowicz A, et al. BMC Biol. 2022 Oct 8;20(1):229. doi: 10.1186/s12915-022-01424-x. PMID: 36209082.
|
|
BC112 |
C. elegans |
dpy-14(e188) unc-13(e51) let-82(s85)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc, and DpyUncLet (DpyUnc Larvae are abnormal). Maintain by picking WT.
|
|
BC115 |
C. elegans |
dpy-14(e188) unc-13(e51) let-81(s88)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncLets are abnormal larvae and die in early larval development. Pick WT to maintain.
|
|
BC124 |
C. elegans |
dpy-14(e188) unc-13(e51) unc-37(s80)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLet. The DpyUncLet larvae are abnormal. Pick WT to maintain.
|
|
BC125 |
C. elegans |
dpy-14(e188) unc-13(e51) let-79(s81)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethal. The DpyUncs are abnormal larvae that die in early larval development. Pick WT to maintain. Note 5/92: probably has lost dpy-14.
|
|
BC215 |
C. elegans |
dpy-14(e188) unc-13(e51) let-78(s82)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae which die in late larval development. Pick WT to maintain.
|
|
BC2507 |
C. elegans |
dpy-18(e364)/eT1 III; unc-60(e677) cdc-25.2(s819) dpy-11(e224)/eT1 V. Show Description
WT strain which segregates WT, Unc-36, and dead eggs. Egg lethal. Maintain by picking WT.
|
|
BC2509 |
C. elegans |
dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-408(s827)/eT1 V. Show Description
WT strain that segregates WT, Unc-36 and dead eggs. Egg lethal. Maintain by picking WT.
|
|
BC2510 |
C. elegans |
dpy-18(e364)/eT1 III; unc-60(e677) let-426(s826) dpy-11(e224)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT.
|
|
BC2513 |
C. elegans |
dpy-18(e364)/eT1 III; dpy-11(e224) let-407(s830)/eT1 V. Show Description
WT strain that segregates WT, Unc-36, dead eggs and DpyLets. Lethal early larval. Maintain by picking WT.
|
|
BC2646 |
C. elegans |
dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-410(s815)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT.
|
|
BC2648 |
C. elegans |
dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-409(s823)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.
|
|
BC2649 |
C. elegans |
dpy-18(e364)/eT1 III; dpy-11(e224) let-337(s825)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT.
|
|
BC2650 |
C. elegans |
dpy-18(e364)/eT1 III; dpy-11(e224) rol-3(s833)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, dead eggs, and DpyRol. Maintain by picking WT.
|
|
BC2908 |
C. elegans |
dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-423(s818)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.
|
|
CF1553 |
C. elegans |
muIs84. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva. Many animals roll weakly or not at all, but still express GFP. Grows at all temperatures.
|
|
CF1580 |
C. elegans |
daf-2(e1370) III; muIs84. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva. Daf-C at 25C. Grows well at 20C.
|
|
CF1588 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muIs84. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Dim green expression in head, tail and around vulva. Daf-d. Can grow at 20C.
|
|