More Fields
Strain Species Genotype
BC352 C. elegans let-51(s41) unc-22(s7)/sDf2 IV. Show Description
Heterozygotes are Twitchers and segregate Twitchers, twitcher progeny that block in egg and dead eggs.
BS7011 C. elegans nemp-1(oz534)/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
Segregates WT RFP+ heterozygotes, viable non-RFP nemp-1(oz534) homozygotes, and RFP+ Dpy. Maintain by picking wild-type RFP+. About 10-20% of nemp-1(oz534) homozygotes are sterile.
BS7012 C. elegans nemp-1(oz535)/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
Segregates WT RFP+ heterozygotes, viable non-RFP nemp-1(oz535) homozygotes, and RFP+ Dpy. Maintain by picking wild-type RFP+. About 10-20% of nemp-1(oz535) homozygotes are sterile.
CGC51 C. elegans sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Dpy mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain BC4279 using CRISPR/Cas9.
GS4335 C. elegans arIs41 II. Show Description
arIs41 [lin-12::GFP + rol-6(su1006)]. Rollers. Reference: Levitan D, Greenwald I. Development. 1998 Aug;125(16):3101-9. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
HRN680 C. elegans wrt-6(aus41) X. Show Description
49-bp deletion. Superficially wild-type. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000169/
NW906 C. elegans pag-1(ls2) III; dpy-20(e1282) IV; seu-2(ev523) evIs41 V. Show Description
evIs41[mec-7::lacZ; mec-7::unc-5; dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.
NW988 C. elegans pag-1(ls2) III; dpy-20(e1282) IV; seu-3(ev555) evIs41 V. Show Description
evIs41[mec-7::lacZ; mec-7::unc-5 + dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.
OD61 C. elegans unc-119(ed3) III; ltIs41. Show Description
ltIs41[pAA5; pie-1::GFP-TEV-STag::CAR-1; unc-119(+)].
RG3088 C. elegans ddp-1(ve588[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygotes have small broods that never mature. Deletion of 401 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 have small broods that never mature (ve588 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaatctatagtttttctcacaggaaATGGA; Right flanking sequence: ttaggctcttttccataaattttcccttaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3121 C. elegans F53A3.7(ve621[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous Sterile. Deletion of 465 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve621 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: agggtttctaaatatcttttaaaacctttg ; Right flanking sequence: AACGTCGTGACACGATAAAGAACGAGAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3167 C. elegans Y54F10AM.5(ve667[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous larval arrest. Deletion of 1461 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve667 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aacttgtgtggatttacgggcaaacagccg ; Right flanking sequence: ACAATATTACTGAAAGCTAGatttctctga. sgRNA #1: ataaaatttgttttgcgcaa; sgRNA #2: AGCGCCAGTCGTTGTATTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
SJ4200 C. elegans zcIs41 V. Show Description
zcIs41 contains [ubl-5p::3xmyc-His tag::ubl-5 + myo-3p::GFP].
SJ4203 C. elegans zcIs39 II; zcIs41 V. Show Description
zcIs39 contains [dve-1p::dve-1::GFP]. zcIs41 contains [ubl-5p::3xmyc-His tag::ubl-5 + myo-3p::GFP].
TS465 C. elegans nca-2(gk5) III; unc-77(gk9) IV; lin-15B&lin-15A(n765) X; vaIs41. Show Description
vaIs41 [nca-2::GFP + lin-15(+)]. Superficially Wild-type.
UP604 C. elegans sos-1(cs41) V. Show Description
Temperature sensitive missense allele. Larval lethal and Vul at 25C. About WT at 20C. Previously called let-341.
AVS411 C elegans artEx30. Show Description
artEx30 [hpk-1p::hpk-1::tdTomato + hsf-1p::hsf-1::GFP + rol-6 (su1006)]. Pick Rollers to maintain. Reference: Das R, PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
AVS413 C. elegans hpk-1(pk1393) X; artEx29. Show Description
artEx29 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion transgene rescues the progeric phenotype of hpk-1(pk1393). Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
BC4586 C. elegans unc-76(e911) rol-9(sc148)/sC4(s2172) [dpy-21(e428)] V. Show Description
Heterozygotes are WT and segregate WT and Unc Rollers. sC4(s2172) is not viable as a homozygote. As a heterozygote it reduces recombination between unc-76 and rol-9 to 1.8%. Note: This strain has been sequenced and the sC4 balancer contains a large deletion from V:16,060,619 to V:19,331,432 that removes 1,279 genes and has a complex rearrangement on LGIV. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9
CER660 C. elegans cer227[mex-5p::SpG(smu-2 introns) + unc-119(+)] II; unc-119(ed3) III. Show Description
Missense mutations D1135L and S1136W, G1218K and E1219Q, and R1335Q and T1337R were introduced on the Cas9 gene at EG9615 strain, to cause endogenous expression of the Cas9 variant SpG. SpG is efficient for CRISPR on NGN PAM sites. Reference: Vicencio J, et al. Nature Communication, 2022. May 12;13(1):2601. doi: 10.1038/s41467-022-30228-4.
DCD23 C. elegans uqIs5. Show Description
uqIs5 [lbp-2p::lbp-2::TagRFP]. Age-dependent aggregation of LBP-2::TagRFP in the pseudocoelom. Reference: Gallotta I, et al. Nature. 2020 Jul 8. doi: 10.1038/s41586-020-2461-z.
GR2255 C. elegans moc-2(mg595) V. Show Description
Can be maintained on OP50. Requires dietary Moco for viability. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
GR2256 C. elegans F49E2.1(mg589) X. Show Description
F49E2.1. Can be maintained on OP50. Requires dietary Moco for viability. Reference: (F49E2.1 referred to as moc-5) Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
GR2257 C. elegans cth-2(mg599) II. Show Description
Can be maintained on OP50. Suppresses Moco-deficient larval lethality. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
GR2260 C. elegans cdo-1(mg622) X. Show Description
Can be maintained on OP50. Suppresses Moco-deficient larval lethality. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
GR3055 C. elegans suox-1(mg663)/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X Show Description
Larval lethal mutation balanced by tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)]. Balancer marked with myo-2p::Venus. Maintain by picking non-Unc GFP+ animals. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP mg663 homozygotes (lethal), and Unc GFP+ (homozygous tmC24). Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
GS416 C. elegans evl-6(ar120)/dpy-13(e184) unc-24(e138) IV. Show Description
Heterozygotes are WT (Dpyish) and segregate WT (Dpyish), DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS419 C. elegans evl-3(ar118)/dpy-10(e128) unc-4(e120) II; him-5(e1467) V. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Throws males. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
HBR1907 C. elegans goeIs410. Show Description
goeIs410 [hsp-16.2p::cnc-6::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-6::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1911 C. elegans goeIs411. Show Description
goeIs411 [hsp-16.2p::cnc-4::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-4::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1912 C. elegans goeIs412. Show Description
goeIs412 [hsp-16.2p::cnc-7::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-7::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1914 C elegans goeIs413. Show Description
goeIs413 [hsp-16.2p::cnc-9::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-9::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HS411 C. elegans ceh-20(os39) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. Segregate GFP- sterile Unc Psa (phasmid socket absent), very rare homozygous hT2 glowing animals, and dead eggs. ceh-20(os39) animals show defects in asymmetric T cell division.
KRA448 C. elegans kasEx157. Show Description
kasEx157 [unc-11p::C9 neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
KRA450 C. elegans kasEx159. Show Description
kasEx159 [unc-11p::(delta)C9 neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene has the unc-11 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
KRA452 C. elegans kasEx161. Show Description
kasEx161 [unc-11p::UAG neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
KRA522 C. elegans kasIs10. Show Description
kasIs10 [snb-1p::UAG ubi + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of snb-1 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
KS411 C. elegans lin-17(n671) I; unc-119(e2498) III; him-5(e1490) V; mhIs9. Show Description
mhIs9 [lin-17::GFP]. Full length lin-17, expressed T.p cells. Rescues lin-17 mutants. unc-119(e2498) may no longer be in the background.
LIU104 C. elegans dhs-28(ldr6) X; ldrIs1; ldrIs2. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr6 is G-to-A causing a G158E substitution. Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The G158E substitution site of the ldr6 mutant is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276
LIU65 C.elegans dhs-28(ldr5) X; ldrIs1; ldrIs2. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr5 is C-to-T substitution causing a premature stop (Q139*). Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The Q139* premature stop in the ldr5 mutant is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276
LIU86 C. elegans dhs-28(ldr4) X; ldrIs1; ldrIs2. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr4 is a G-to-A mutation in the splice donor site of Intron 1. Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The G-to-A mutation in the splice donor site is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276
MIR260 C. elegans risIs31. Show Description
risIs31 [hsp-16.2p::grh-1b::GFP + unc-119(+)]. Long lived without heat shock. Heat shock induces over-expression of grh-1 causing short-lived phenotype and nuclear GFP expression. Described as "hsp-16.2p::grh-1::gfp OEx line 1" in referenced paper. Reference: Grigolon G, et al. Nat Commun. 2022 Jan 10;13(1):107. doi: 10.1038/s41467-021-27732-4. PMID: 35013237.
MIR262 C. elegans risls32. Show Description
risls32 [grh-1p::grh-1b::GFP + unc-119(+)]. Over-expression of grh-1 from its endogenous promoter. Short lived, no GFP signal visible. Reference: Grigolon G, et al. Nat Commun. 2022 Jan 10;13(1):107. doi: 10.1038/s41467-021-27732-4. PMID: 35013237.
NKZ35 C. inopinata Caenorhabditis inopinata wild isolate Show Description
Caenorhabditis inopinata wild isolate; 10x inbred line. Male-Female. Maintain by mating at 25C or above; does not grow well at 20C. See reference for the details d(https://www.nature.com/articles/s41467-018-05712-5). Sibling species of C. elegans. Inbred 10 times, full genome sequence available. Frozen stock recovery is lower efficiency than C. elegans with glycerol; DMSO method works more efficiently. Adult: Large and slender species; ca. 1.5–2.5?mm in length, and individuals may reach up 3.0?mm under optimal culturing conditions. Cuticle is moderate to thick with four-lined lateral field. Deirids on the lateral field, at the level slightly behind the secretory–excretory pore. Lip separated into six sectors, not clearly offset. Six labial sensilla and four cephalic sensilla present. The anterior end of each lip sector very slightly elongated and forming six stomatal flaps. Amphid small, oval pore-like, at the level of the margin of cheilo and gymnostom. Tube-like stoma separated into three parts; short tube-like cheilostom; simple tube-like gymnostom, which is weakly separated into two subsections; and tube-like stegostom covered by pharyngeal sleeve, which is separated into four subsections, prostegostom, mesostegostom, metastegostom, and telostegostom. Metastegostomatal three teeth flap-like. Pharynx separated into four sections; procorpus forming muscular tube, well-developed metacorpus (median bulb); glandular and narrow isthmus; and basal bulb with double haustrulum as the glottoid apparatus. Pharyngo-intestinal valve (cardia) prominent. Nerve ring around the middle of isthmus. Excretory pore located around the margin of isthmus and basal bulb. Female: Gonadal system didelphic, amphidelphic. Anterior and posterior gonadal system are basically symmetric with each other, arranged as ovary, oviduct, spermatheca, spermathecal-uterus junction tissue, uterus and vulva/vagina from distal. Sometimes more than 20 developing eggs are deposited. Tail conical or forming slightly elongated conus with pointed tip. Anus and rectum clearly visible; three (two subventral and one dorsal) rectal glands present. Phasmid forming small pore at ca. 60% of total tail length from anus. Male: Testis single, anteriorly reflexed rightwardly. Vas deferens occupying ca. 1/5 of total gonadal length. Tail enveloped by a closed bursa, supported by nine pairs of bursal rays. Anterior cloacal lip with a rounded and sclerotized appendage and bulge-like appendage between rounded appendage and cloacal opening; a small sensilla-like papilla on the bulge-like appendage. Posterior cloacal lip with tongue-like appendage with two cloacal sensilla. Spicules paired, separate, long and slender with evenly slightly ventrally curved blade and simply pointed tip. Gubernaculum slender, ventrally arcuate with small squared appendage at the distal end in lateral view. Bursa heart-shaped in ventral view, anteriorly closed with serrated edge; serratae obvious in anterior half and vague in posterior half; terminal notch present but unclear. The nine pairs of genital papillae or bursal rays supporting the bursal velum with an arranged (2/1?+?1?+?2?+?3).
NM1448 C. elegans jsIs37 rpm-1(js410) V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Reduced SNB-1::GFP localization to synaptic regions; slighty Dpy. js410 has linked phenotype of reduced brood size. js410 is an R->Stop at aa 235. snb-1::GFP is expressed in mechanosensory neurons visible in the cell body and in the axon (very low levels). GFP puncta absent from the ventral nerve cord due to rpm-1 lesion.
OD3609 C elegans faah-4(lt121) III. Show Description
NOTE: This strain can be sensitive to starvation; the authors recommend that anyone using this strain for their work should propagate the stock for several generations after starvation before conducting experiments. Reference: Chen AL, et al. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0243-4.
OH11319 C. elegans otIs412 X. Show Description
otIs412 [unc-3p::GFP + rgef-1p::DsRed] X. GFP expression in DA/DB/VA/VB class neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH11416 C. elegans otIs419. Show Description
otIs419 [snb-1p(prom17)::2xNLS::GFP + elt-2::DsRed2]. Ubiquitous GFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OP411 C. elegans unc-119(tm4063) III; wgIs411. Show Description
wgIs411 [nhr-90::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OP412 C. elegans unc-119(tm4063) III; wgIs412. Show Description
wgIs412 [nhr-168::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)