More Fields
Strain Species Genotype
GA631 C. elegans lin-15B&lin-15A(n765) X; wuIs177. Show Description
wuIs177 [ftn-1p::GFP + lin-15(+)]. GFP expression in the intestine. ftn-1p::GFP transgene shows moderate basal expression under standard culture conditions in an otherwise wild-type background, but is strongly induced by reduced insulin/IGF-1 signalling, reduced HIF signalling, and increased free iron levels. References: Ackerman D & Gems D. PLoS Genet. 2012;8(3):e1002498. Valentini S, et al. Mech Ageing Dev. 2012 May;133(5):282-90.
HA2823 C.elegans smn-1(rt248) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); nuIs175 X. Show Description
nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752.
HA2825 C.elegans smn-1(ok355) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); rtSi10 IV; nuIs175 X. Show Description
rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752
HS1749 C. elegans mig-1(e1787) lin-17(n671) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT GFP+ heterozygotes, non-GFP Unc Sys, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.
HS178 C. elegans psa-3(os8) X. Show Description
Superficially WT. Defects in asymmetric T cell division causes Psa (phasmid socket absent) phenotype.
HS1790 C. elegans mig-1(e1787) lin-17(n671) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); cfz-2(ok1201) V. Show Description
mig-1 confirmed by complementation tests, and cfz-2 by PCR. Segregates WT GFP+ heterozygotes, non-GFP Unc Sys, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.
HS1795 C. elegans dsh-2(or302) mig-5(tm2639)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT with pharyngeal GFP. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and few GFP- dsh-2(or302) mig-5(tm2639) homozygotes (Sys). Pick WT GFP+ animals and check for correct segregation of progeny to maintain.
JH2107 C. elegans unc-119(ed3) III; axIs1720. Show Description
axIs1720 [pie-1p::GFP::pgl-1 ORF::pgl-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2281 C. elegans unc-119(ed3) III; axIs1729. Show Description
axIs1729 [pie-1p::LAP tag::mCherry::nos-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2365 C. elegans unc-119(ed3) III; axIs1702. Show Description
axIs1702 [pie-1p::GFP::fbf-2 ORF::fbf-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2366 C. elegans unc-119(ed3) III; axIs1703. Show Description
axIs1703 [spe-11p::GFP::histone H2B::tbb-2 3'utr + unc-119(+)].
JH2373 C. elegans unc-119(ed3) III; axIs1709. Show Description
axIs1709 [pie-1p::GFP::histone H2B:lip-1M1M2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.
JH2377 C. elegans unc-119(ed3) III; axIs1713. Show Description
axIs1713 [pie-1p::GFP::histone H2B::mes-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is very unstable. Pick non-Unc, GFP+ worms to maintain.
JH2379 C. elegans unc-119(ed3) III; axIs1715. Show Description
axIs1715 [pie-1p::GFP::histone H2B::pie-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2380 C. elegans unc-119(ed3) III; axIs1716. Show Description
axIs1716 [pie-1p::GFP::histone H2B::unc-54 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.
JH2381 C. elegans unc-119(ed3) III; axIs1717. Show Description
axIs1717 [pie-1p::GFP::histone H2B::spe-41 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2416 C. elegans unc-119(ed3) III; axIs1742. Show Description
axIs1742 [lip-1p::GFP::histone H2B::tbb-2 3'utr + unc-119(+)].
JH2418 C. elegans unc-119(ed3) III; axIs1721. Show Description
axIs1721 [pie-1p::GFP::histone H2B::puf-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2423 C. elegans unc-119(ed3) III; axIs1722. Show Description
axIs1722 [pie-1p::GFP::histone H2B::fog-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2427 C. elegans unc-119(ed3) III; axIs1751. Show Description
axIs1751 [pie-1p::GFP::histone H2B::pos-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.
JH2428 C. elegans unc-119(ed3) III; axIs1752. Show Description
axIs1752 [fbf-1p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. Maintaining at 25C might reduce the chance of transgene silencing.
JH2432 C. elegans unc-119(ed3) III; axIs1756. Show Description
axIs1756 [fbf-2p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. Maintaining at 25C might reduce the chance of transgene silencing.
JH2434 C. elegans unc-119(ed3) III; axIs1758. Show Description
axIs1758 [spn-4p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.
JH2435 C. elegans unc-119(ed3) III; axIs1759. Show Description
axIs1759 [msp-56p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)].
JH2436 C. elegans unc-119(ed3) III; axIs1723. Show Description
axIs1723 [pie-1p::GFP::histone H2B:gld-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2458 C. elegans unc-119(ed3) III; axIs1735. Show Description
axIs1735 [pie-1p::LAP tag::npp-10 (full length) + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2464 C. elegans unc-119(ed3) III; axIs1779. Show Description
axIs1779 [pie-1p::mCherry::H2B::tbb-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2471 C. elegans unc-119(ed3) III; axIs1775. Show Description
axIs1775 [pie-1p::GFP::histone H2B:gld-1 M1M2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Pick wild-type worms to maintain.
JH2513 C. elegans fbf-1(ok91) II; axIs1723. Show Description
axIs1723 [pie-1p::GFP::H2B::gld-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.
JH2523 C. elegans fbf-2(q738) II; axIs1722. Show Description
axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.
JH2525 C. elegans fbf-1(ok91) II; axIs1722. Show Description
axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.
JH2840 C. elegans unc-119(ed3) III; axIs???? ; axIs1731. Show Description
axIs??? [nmy-2p::pgl-1::GFP::patr-1::nmy-2 3'UTR]. axIs1731 [pie-1p::mCherry::mex-5::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2877 C. elegans fbf-2(q738) II; pgl-1(ct131) him-3(e1147) III; axIs1722. Show Description
axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.
JH2881 C. elegans pgl-1(ct131) him-3(e1147) III; axIs1702. Show Description
axIs1702 [GFP::fbf-2 + unc-119(+)]. Maintain at >22C to maintain transgene expression. Unknown if ed3 is still in background.
JH2883 C. elegans fbf-1(ok91) II; pgl-1(ct131) him-3(e1147) III; axIs1722. Show Description
axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.
JJ1850 C. elegans unc-119(ed3) III; zuIs178. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. HIS-72::GFP can be detected in germline and most somatic nuclei, but not in intestinal nuclei. Not integrated on X.
JK4626 C. elegans cku-80(ok861) unc-119(ed3) III; qIs170. Show Description
qIs170 [gld-1p::gld-1::GFP::FLAG + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Jeong J, Verheyden JM, Kimble J. PLoS Genet. 2011 Mar;7(3):e1001348.
JN1709 C. elegans peIs1709. Show Description
peIs1709 [gpc-1p::FLAG::pab-1::sl2::NLS::GFP + unc-122p::mCherry]. FLAG-tagged poly(A)-binding protein (PAB-1) can be used for mRNA tagging. Reference: Tomioka M, et al. Nat Commun. 2016 May 20;7:11645. PMID: 27198602
JN1710 C. elegans peIs1710. Show Description
peIs1710 [glr-1p::FLAG::pab-1::sl2::NLS::GFP + unc-122p::mCherry]. FLAG-tagged poly(A)-binding protein (PAB-1) can be used for mRNA tagging. Reference: Tomioka M, et al. Nat Commun. 2016 May 20;7:11645. PMID: 27198602
JN1713 C. elegans peIs1713. Show Description
peIs1713 [sra-6p::mCasp-1 + unc-122p::mCherry]. ASH neurons are eliminated. Abnormal odor chemotaxis. Reference: Yoshida K, et al. Nat Commun. 2012 Mar 13;3:739.
JN1715 C. elegans peIs1715. Show Description
peIs1715 [str-1p::mCasp-1 + unc-122p::GFP]. AWB neurons are eliminated. Abnormal odor chemotaxis. Reference: Yoshida K, et al. Nat Commun. 2012 Mar 13;3:739.
LE2791 C. elegans lqIs170 X. Show Description
lqIs170 [F25B3.3p::vab-10(ABD)::GFP + ttx-3::RFP] X. Pan-neuronal GFP expression. Reference: Norris AD & Lundquist EA. Development. 2011 Oct;138(20):4433-42.
LX1960 C. elegans lite-1(ce314) lin-15B&lin-15A(n765) X; vsIs172. Show Description
vsIs172 [lin-11(enhancer)::pes-10p::GCaMP5 + lin-11(enhancer)::pes-10p::mCherry + lin-15(+)]. Integrated transgene using lin-11 enhancer region fused to the pes-10 basal promoter to drive GCaMP5 and mCherry expression in VC motor neurons; useful for visualizing and quantitating calcium influx in VC motor neurons. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.
LX1986 C. elegans vsIs177 lite-1(ce314) lin-15B&lin-15A(n765) X. Show Description
vsIs177 [ocr-2p::GCaMP5::ocr-2 3'UTR + ocr-2p::mCherry::ocr-2 3'UTR + lin-15(+)] X. Integrated transgene using ocr-2 promoter to drive GCaMP5 and mCherry expression in uv1; useful for visualizing and quantitating calcium influx in uv1 cells. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.
MT15695 C. elegans nIs175 IV; ceh-34(4796) V. Show Description
nIs175 [ceh-28p::4xNLS::GFP + lin-15(+)] IV. Extra GFP+ M4 observed in nIs175. Reference: Takashi H, et al. PNAS 2010 Aug 31;107(35):15479-84.
MT16231 C. elegans nIs177 sptf-3(n4850) I. Show Description
nIs177 [ceh-28p::4NLS::GFP + lin-15(+)]. Extra ceh-28p::4NLS::GFP-expressing M4 seen in nIs177 (~30% penetrance). Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
MT19851 C. elegans sptf-3(tm607)/hIn1 [unc-101(sy241)] nIs425 I; nIs175 IV. Show Description
nIs425 [myo-2p::GFP] I. nIs175 [ceh-28p::4NLS::GFP + lin-15(+)] IV. Heterozygotes are GFP+ wild type and segregate GFP+ Unc, GFP+ wild type, and GFP- sptf-3 homozygotes. nIs425 was integrated into sptf-3(tm607)/hIn1[unc-101(sy241)] I. The position of integration appears to be close to or lie within the region covered by hIn1: sptf-3(tm607) heterozygotes are GFP+ whereas sptf-3(tm607) homozygotes do not express GFP in the pharynx. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
NK885 C. elegans unc-119(ed4) III; qyIs174. Show Description
qyIs174 [hlh-2p::GFP::hlh-2 + unc-119(+)]. Translational fusion protein displaying cytoplasmic and nuclear localization; contains 8 kb upstream, N-terminal GFP fusion, full open reading frame and 3'UTR. Reference: Schindler AJ, Sherwood DR. Dev Biol. 2011 Sep 15;357(2):380-91.
NK887 C. elegans unc-119(ed4) III; qyIs176. Show Description
qyIs176 [zmp-1(50-51)p::mCherry::moeABD + unc-119(+)]. Reference: Schindler AJ, Sherwood DR. Dev Biol. 2011 Sep 15;357(2):380-91.
OH3701 C. elegans otIs173 III. Show Description
otIs173 [F25B3.3::DsRed2 + ttx-3pB::GFP].