More Fields
Strain Species Genotype
OH4134 C. elegans otIs173 III; zdIs13 IV. Show Description
otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP] III. zdIs13 [tph-1p::GFP] IV.
OH4135 C. elegans otIs173 III; zdIs13 IV; wrk-1(ok695) X. Show Description
otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP]. zdIs13 [tph-1p::GFP] IV.
OH7074 C. elegans otIs173 III; ttx-3(ot355) X. Show Description
otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
OH7075 C. elegans otIs173 III; ttx-3(ot356) X. Show Description
otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
OH7076 C. elegans otIs173 III; ttx-3(ot357) X. Show Description
otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
OH7079 C. elegans otIs173 III; ttx-3(ot360) X. Show Description
otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
OH7103 C. elegans otIs173 III; ttx-3(ot365) X. Show Description
otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
OH9330 C. elegans hlh-3(ot354) II; otIs173 III. Show Description
otIs173 [F25B3.3::DsRed2 + ttx-3promB::GFP] III. Whole genome sequenced strain. Reference: Sarin S, et al., Genetics. 2010 Jun;185(2):417-30.
OP171 C. elegans unc-119(ed3) III; wgIs171. Show Description
wgIs171 [egl-38::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OP174 C. elegans unc-119(ed3) III; wgIs174. Show Description
wgIs174 [ces-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OP175 C. elegans unc-119(ed3) III; wgIs175. Show Description
wgIs175 [lir-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OP177 C. elegans unc-119(ed3) III; wgIs177. Show Description
wgIs177 [egl-27::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of egl-27 coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OP178 C. elegans unc-119(ed3) III; wgIs178. Show Description
wgIs178 [skn-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of skn-1 coding sequence of fosmid ID#WRM0641aG02 by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OP179 C. elegans unc-119(ed3) III; wgIs179. Show Description
wgIs179 [gei-11::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OP217 C. elegans unc-119(ed3) III; ddIs172. Show Description
ddIs172 [aly-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OS1776 C. elegans hsf-1(sy441) I; nsEx992. Show Description
nsEx992 [vap-1::hsf-1 + hsp::FRT-GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP expression in amphid sheath cells and occasionally gut following heat shock. Reference: Bacaj T, Shaham S. Genetics. 2007 Aug;176(4):2651-5.
PS1702 C. elegans dpy-20(e1282) IV; syIs20 him-5(e1490) V. Show Description
syIs20 [gpa-1::lacZ + dpy-20(+)] V. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4997 C. elegans unc-119(e2498) III; syIs179. Show Description
syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
RT476 C. elegans unc-119(ed3) III; pwIs170. Show Description
pwIs170 [vha6p::GFP::rab-7 + Cbr-unc-119(+)].
RW10006 C. elegans unc-119(ed3) ruIs32 III; zuIs178 V. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. Ubiquitous histone-GFP fusion protein in embryo and adult germline as well as many adult somatic cells.
RW10007 C. elegans pha-1(e2123) stIs10007 III; zuIs178 V. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10007 [pha-4 (4.1kb)) H3::H3::GFP::H3 3'UTR + pie-1p::H2B::GFP::pie-1 3'UTR + pha-4p::H1::DsRed::T1::let-858 3'UTR]. May still contain ruIs32 [pie-1::H2B-GFP + unc-119(+)] in the background.
RW10029 C. elegans zuIs178; stIs10024. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. May still have unc-119(ed3) in the background.
RW10048 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10044. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10044 [mir-57::HIS-24::mCherry + unc-119(+)].
RW10060 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10060. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10060 [cnd-1(3.2kb)::HIS-24::mCherry + unc-119(+)].
RW10062 C. elegans unc-119(ed3) III; zuIs178 V; stIs10050. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10050 [pha-4(4kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
RW10064 C. elegans unc-119(ed3) III; zuIs178 V; stIs10064. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10064 [end-3::H1-wCherry::let-858 3' UTR + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
RW10083 C. elegans unc-119(ed3) III; zuIs178 V; stIs10059. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10059 [cnd-1(3.2kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
RW10084 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10039. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10039 [mir-61::H1.1-GFP::let-858 3' UTR + unc-119(+)].
RW10097 C. elegans unc-119(ed3) III; zuIs178 V; stIs10088. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10088 [hlh-1(3.3kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
RW10098 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10035. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10035 [eft-3-L2::H1-wCherry + unc-119(+)].
RW10108 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10086. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10086 [ges-1::H1-wCherry + unc-119(+)].
RW10131 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10131. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10131 [elt-7::H1-wCherry + unc-119(+)].
RW10166 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10157. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10157 [dpy-7::H1-wCherry + unc-119(+)].
RW10174 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10174. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10174 [pal-1::H1-wCherry + unc-119(+)].
RW10175 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10138. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10138 [tbx-38::H1-wCherry + unc-119(+)].
RW10177 C. elegans unc-119(ed3) III; zuIs178; stIs10177. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10177 [cwn-1::H1-wCherry::his-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
RW10196 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10122. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10122 [hnd-1::MycCherry I (modENCODE39) + unc-119(+)].
RW10197 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10137. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10137 [med-2::H1-wCherry + unc-119(+)].
RW10199 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10140. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10140 [vab-7::H1-wCherry + unc-119(+)].
RW10206 C. elegans unc-119(ed3) III; zuIs178; stIs10308. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10308 [die-1::H1-wCherry::let-858 3'UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
RW10230 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10224. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10224 [lin-39::H1-wCherry + unc-119(+)].
RW10234 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10220. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10220 [end-1::H1-wCherry + unc-119(+)].
RW10238 C. elegans unc-119(ed3) III; zuIs178; stIs10190. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10190 [C08B11.3::H1-wCherry::let-858 3'UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
RW10249 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10218. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10218 [tbx-11::H1-wCherry + unc-119(+)].
RW10265 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10143. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10143 [tbx-8::H1-wCherry + unc-119(+)].
RW10345 C. elegans unc-119(ed3) III; zuIs178; stIs10322. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10322 [ceh-43::H1-wCherry::his-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
RW10346 C. elegans unc-119(ed3) III; zuIs178; stIs10323. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10323 [elt-1::H1-wCherry::let-858 3'UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
RW10371 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10335. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10335 [sdz-28::H1-wCherry + unc-119(+)].
RW10375 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10340. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10340 [tbx-9::H1-wCherry + unc-119(+)].
RW10386 C. elegans unc-119(ed3) III; zuIs178; stIs10276. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10276 [C50F7.5::H1-wCherry::let-858 3' UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.