| BC1573 |
C. elegans |
+/eT1 III; let-402(s127) dpy-11(e224) unc-42(e270)/eT1 V. Show Description
WT strain which segregates WT, Unc-36, dead eggs and DpyUncLets. Lethal mid larval. Maintain by picking WT.
|
|
| DV3312 |
C. elegans |
rgl-1(re179[mNeonGreen::3xFlag::rgl-1]) X. Show Description
Ubiquitous expression with cytosolic localization. Derived in an N2 background.
Detection with triplex primers:
HS125 5-CTTGTCACTGTAAGGGAAGATTTCC-3
HS126 5-TTGTCCTCCTCTCCCTTGG-3
HS127 5 ACGTAGAATGTTCCAGAGTTCCAG-3'
Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
| NK1339 |
C. elegans |
rrf-3(pk1426) II; qyIs127 V; qyIs166 X. Show Description
qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. qyIs166 [cdh-3p::GFP::CAAX + unc-119(+)] X. Temperature-sensitive sterile; maintain at 20C or lower for optimum fertility. Increased sensitivity to RNAi when compared to wild-type animals. lam-1p::lam-1::mCherry expression can be weak and variable. Reference: Kelley, LC, et al. Developmental Cell. 2019 Feb 11;48(3):313-328.e8.
|
|
| NK696 |
C. elegans |
unc-119(ed4) III; qyIs127. Show Description
qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
|
|
| OP127 |
C. elegans |
unc-119(ed3) III; wgIs127. Show Description
wgIs127 [him-8::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
|
|
| TX1377 |
C. elegans |
unc-119(ed3) III; teIs127. Show Description
teIs127 [pie-1p::GFP::H2B::mom-2 3'UTR + unc-119(+)] teIs127 construct includes a 557 bp genomic sequence beginning 100 bp upstream of the mom-2 stop codon was cloned downstream of pie-1 promoter-driven GFP::H2B. Superficially wild-type. Reference: Oldenbroek M, et al. Development. 2013 Nov;140(22):4614-23.
|
|
| VPR127 |
C. elegans |
vprIs127. Show Description
vprIs127 [hlh-17p::GFP]. Unc, backward ventral coiler.
|
|
| WBM1471 |
C. elegans |
wbmIs133 V. Show Description
wbmIs133 [rab-3p::3XFLAG::rpl-22::SL2::scarlet::rab-3 3'UTR, *wbmIs127] (V:8645000). N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs127. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
|
|
| ZX2604 |
C. elegans |
sng-1(ok234) X; zxIs127. Show Description
zxIs127 [sng-1p::SNG-1::CRY2olig(535) + myo-2p::mCherry]. Strain should be kept in the dark; it is very light-sensitive. Pan-neuronal expression of a truncated variant of Arabidopsis thaliana Cryptochrome-2 fused to synaptogyrin. If illuminated with blue light, synaptic vesicles cluster, resulting in inhibition of synaptic transmission. Synaptic transmission is restored within 15 minutes in the absence of light (ca. 6.5min time constant), resulting in normal wild type behavior afterwards. Reference: Vettkotter D, et al. Nat Commun 13, 7827 (2022). https://doi.org/10.1038/s41467-022-35324-z. PMID: 36535932
|
|
| BC12792 |
C. elegans |
dpy-5(e907) I; sIs12792. Show Description
sIs12792[rCesF41E7.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC12912 |
C. elegans |
dpy-5(e907) I; sIs12716. Show Description
sIs12716 [rCes Y41D4A.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC12924 |
C. elegans |
dpy-5(e907) I; sIs12798. Show Description
sIs12798 [rCesZK470.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC12926 |
C. elegans |
dpy-5(e907) I; sIs12782. Show Description
sIs12782 [rCes K04D7.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC12956 |
C. elegans |
dpy-5(e907) I; sIs12739. Show Description
sIs12739 [rCesF25G6.5::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC12967 |
C. elegans |
dpy-5(e907) I; sIs12797. Show Description
sIs12797 [rCesY57G11C.20::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with low intensity GFP expression in larval and adult. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC12969 |
C. elegans |
dpy-5(e907) I; sIs12774. Show Description
sIs12774 [rCesF52H2.5::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC12986 |
C. elegans |
dpy-5(e907) I; sIs12773. Show Description
sIs12773 [rCesF09C3.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC12988 |
C. elegans |
dpy-5(e907) I; sIs12777. Show Description
sIs12777 [rCesF53H8.2::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC12994 |
C. elegans |
dpy-5(e907) I; sIs12736. Show Description
sIs12736 [rCesC35B1.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC12997 |
C. elegans |
dpy-5(e907) I; sIs12740 . Show Description
sIs12740 [rCes T04A8.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC13074 |
C. elegans |
dpy-5(e907) I; sIs12775. Show Description
sIs12775 [rCesF28F9.1::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC13083 |
C. elegans |
dpy-5(e907) I; sIs12735. Show Description
sIs12735 contains [rCes C31C9.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC13172 |
C. elegans |
dpy-5(e907) I; sIs12730. Show Description
sIs12730 [rCesM88.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC1972 |
C. briggsae |
Cbr-unc(s1270). Show Description
C. briggsae strain. Twitcher. Hets twitch only in prescence of nicotine.
|
|
| BC1977 |
C. briggsae |
Cbr-unc(s1275). Show Description
C. briggsae strain. Unc-tends to coil.
|
|
| CHS1270 |
C. elegans |
sri-57(yum2707) sri-61(yum2708) sri-62(yum2709) sri-63(yum2710) sri-65(yum2711) sri-78(yum2712) sri-54(yum2713) sri-60(yum2714) y27f2a.11(yum2715) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1271 |
C. elegans |
srh-166(yum2716) srh-167(yum2717) srh-169(yum2718) srh-146(yum2719) srh-147(yum2720) srh-148(yum2721) srh-149(yum2722) srh-154(yum2723) srh-159(yum2724) srh-170(yum2725) srh-171(yum2726) srh-172(yum2727) srh-173(yum2728) srh-174(yum2729) srh-177(yum2730) srh-178(yum2731) srh-179(yum2732) srh-180(yum2733) srh-181(yum2734) srh-182(yum2735) srh-183(yum2736) srh-184(yum2737) srh-308(yum2738) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1272 |
C. elegans |
srbc-1(yum2739) srbc-2(yum2740) srbc-3(yum2741) srbc-5(yum2742) srbc-6(yum2743) srbc-7(yum2744) srbc-8(yum2745) srbc-9(yum2746) srbc-10(yum2747) srbc-11(yum2748) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1273 |
C. elegans |
srh-74(yum2749) srh-75(yum2750) srh-76(yum2751) srh-78(yum2752) srh-79(yum2753) srh-80(yum2754) srh-82(yum2755) srh-83(yum2756) srh-85(yum2757) srh-87(yum2758) srh-88(yum2759) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1274 |
C. elegans |
srh-24(yum2760) srh-25(yum2761) srh-27(yum2762) srh-28(yum2763) srh-30(yum2764) srh-31(yum2765) srh-32(yum2766) srh-46(yum2767) srh-47(yum2768) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1275 |
C. elegans |
mgl-1(yum2769) mgl-2(yum2770) mgl-3(yum2771) c30a5.10(yum2772) f35h10.10(yum2773) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1276 |
C. elegans |
str-123(yum2774) str-124(yum2775) str-125(yum2776) str-129(yum2777) str-130(yum2778) str-131(yum2779) str-134(yum2780) str-135(yum2781) str-136(yum2782) str-145(yum2783) t06c12.11(yum2784) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1277 |
C. elegans |
srt-27(yum2785) srt-28(yum2786) srt-29(yum2787) srt-30(yum2788) srt-31(yum2789) srt-32(yum2790) srt-33(yum2791) srt-34(yum2792) srt-74(yum2793) srt-35(yum2794) srt-36(yum2795) srt-37(yum2796) srt-38(yum2797) srt-39(yum2798) srt-40(yum2799) srt-41(yum2800) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1278 |
C. elegans |
str-63(yum2801) str-64(yum2802) str-66(yum2803) str-61(yum2804) str-67(yum2805) str-68(yum2806) str-69(yum2807) c41g6.12(yum2808) str-52(yum2810) str-60(yum2811) str-71(yum2812) str-73(yum2813) str-74(yum2814) str-77(yum2815) f22f7.12(yum2816) str-76(yum2817) str-265(yum2818) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| NL2334 |
C. elegans |
dpy-20(e1282) IV; pkIs1273. Show Description
pkIs1273 [gpa-16::GFP + dpy-20(+)].
|
|
| NL2336 |
C. elegans |
dpy-20(e1282) IV; pkIs1275. Show Description
pkIs1275 [gpc-2::GFP + dpy-20(+)]. Reporter construct includes 2.3 kbp of upstream sequence and most of the gpc-2 open reading frame. 2.5 kbp PCR fragment generated with primers gpc2-1 (TCTGCAGCACGACGATAATC, extended with a SphI site) and gpc2-2 (GTCGATTGGGTTCACAAGTG, extended with a BamHI site) into vector pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94.
|
|
| OS12700 |
C. elegans |
unc-30(ns959[unc-30::GFP::degron]) IV. Show Description
Linker with GFP tag and degron inserted at the C terminus of the endogenous unc-30 locus. GFP expression in ASG, AVJ, DD, VD, and PVP neurons and GLR glia. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
|
|