BC1574 |
C. elegans |
+/eT1 III; let-403(s120) dpy-11(e224) unc-42(e270)/eT1 V. Show Description
WT strain which segregates WT, Unc-36, dead eggs and DpyUncLets. Lethal mid-late larval. Maintain by picking WT.
|
|
CF2005 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muIs120. Show Description
muIs120 [ges-1p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Long-lived. Gamma irradiation-induced integration of muEx211. Rescues daf-16a1/c in the intestine (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.
|
|
KN1510 |
C. elegans |
huIs120. Show Description
huIs120 [hsp-16.2p::sfrp-1 + myo-2p::Tomato]. Wild-type under normal culture conditions. Heat-shock (10 min) during embryogenesis causes embryonic lethality and HSN migration defects. Heat-shock (10 min) at hatching causes Ql and QR migration defects. Reference: Harterink M, et al. Development. 2011 Jul;138(14):2915-24.
|
|
OP120 |
C. elegans |
unc-119(ed3) III; wgIs120. Show Description
wgIs120 [ceh-30::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
YQ95 |
C. elegans |
unc-119(ed3) III; atg-18(gk378) V; wfIs120. Show Description
wfIs120 [app-1p::atg-18::unc-54 + unc-119(+)]. Intestine-specific promoter app-1 drives atg-18 expression in the atg-18(gk378) mutant background, providing rescue in intestinal cells. Reference: Chen HD, et al. Autophagy. 2016 Nov 22:1-15.
|
|
AUM1535 |
C. elegans |
drsh-1(viz43)/tmC18[dpy-5(tmIs1200[myo-2p::mVenus])] I. Show Description
[D943G] substitution mutation in conserved residue within RNAse III domain. Balancer marked with myo-2p::Venus. Pick fertile wild-type (non-Dpy) Venus+ to maintain. drsh-1(viz43) homozygous animals display heterochronic phenotypes beginning at L3/L4 molt and typically burst at the vulva in L4. Heterozygotes are wild-type with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus viz-43 homozygotes, and Dpy Venus+ tmC18 homozygotes. Reference: Barish S, et al. Human Mol Genet. 2022 Aug 25;31(17):2934-2950. doi: 10.1093/hmg/ddac085. PMID: 35405010.
|
|
BC12357 |
C. elegans |
dpy-5(e907) I; sIs12078. Show Description
sIs12078 [rCes T08G11.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC12358 |
C. elegans |
dpy-5(e907) I; sIs12098. Show Description
sIs12098 [rCesC05B5.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC12361 |
C. elegans |
dpy-5(e907) I; sIs12069. Show Description
sIs12069 [rCesR05F9.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC12418 |
C. elegans |
dpy-5(e907) I; sIs12097. Show Description
sIs12097 [rCes T10F2.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC12420 |
C. elegans |
dpy-5(e907) I; sIs12076. Show Description
sIs12076 [rCesC34F11.9a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC12668 |
C. elegans |
dpy-5(e907) I; sIs12029. Show Description
sIs12029 [rCesT08H4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC12897 |
C. elegans |
dpy-5(e907) I; sIs12060. Show Description
sIs12060 [rCesZK430.2::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC13081 |
C. elegans |
dpy-5(e907) I; sIs12018. Show Description
sIs12018 [rCesB0228.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC13491 |
C. elegans |
dpy-5(e907) I; sIs12001. Show Description
sIs12001 [rCes T06G6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC2107 |
C. elegans |
unc-22(s7) unc-31(e169) let-314(s1206)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Egl, UncLet and dead eggs. Lethal at embryo-early larval. Maintain by picking WT.
|
|
BC3119 |
C. elegans |
unc-5(e152) unc-22(s7) let-99(s1201) unc-31(e169) IV/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Egl, UncLet (maternal effect lethal) and dead eggs. Maintain by picking WT.
|
|
CER250 |
C. elegans |
ubh-4(cer25[F73V]) II. Show Description
Superficially wild-type. ubh-4(cer25[F73V]) is a missense mutation mimicking a human BAP1 cancer mutation. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270
|
|
CER323 |
C. elegans |
ubh-4(cer27) II. Show Description
Reduced brood size. Genetic interaction with rpn-9. cer27 is a 1033 bp deletion removing the start codon and nearly all of the ubh-4 coding sequence. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270
|
|
CER344 |
C. elegans |
ubh-4(cer32[A87D]) II. Show Description
Superficially wild-type. ubh-4(cer32[A87D]) is a missense mutation mimicking a human BAP1 cancer mutation. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270
|
|
CER522 |
C. elegans |
ubh-4(cer140) rpn-9(gk401)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP cer140 gk401 homozygotes (synthetic sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. Generated by CRISPR-mediated deletion of ubh-4 in gk401 mutant background. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270
|
|
CER620 |
C. elegans |
ubh-4(cer68[ubh-4::eGFP]) rpn-9(cer203[rpn-9::wrmScarlet]) II Show Description
eGFP tag inserted into endogenous ubh-4 locus. wrmScarlet tag inserted into endogenous rpn-9 locus. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270
|
|
CHS1200 |
C. elegans |
srd-53(yum2200) srd-54(yum2201) srd-55(yum2202) srd-56(yum2203) srd-58(yum2204) srd-59(yum2205) I. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1201 |
C. elegans |
str-43(yum2206) str-44(yum2207) str-45(yum2208) str-46(yum2209) str-47(yum2210) str-48(yum2211) str-38(yum2212) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1202 |
C. elegans |
sre-26(yum2213) sre-27(yum2214) sre-28(yum2215) sre-32(yum2216) sre-33(yum2217) sre-49(yum2218) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1203 |
C. elegans |
t27e7.9(yum1046) t27e7.4(yum1047) t27e7.5(yum1048) t27e7.3(yum1049) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1204 |
C. elegans |
t03e6.9(yum2219) t03e6.8(yum2220) y37h2c.4(yum2221) c53d6.11(yum2222) w06g6.15(yum2223) y70c5b.2(yum2224) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1205 |
C. elegans |
srw-56(yum2225) srw-57(yum2226) srw-59(yum2227) srw-60(yum2228) srw-61(yum2229) srw-62(yum2230) srw-63(yum2231) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1206 |
C. elegans |
srt-19(yum2232) srt-20(yum2233) srt-22(yum2234) srt-15(yum2235) srt-16(yum2236) srt-17(yum2237) srt-18(yum2238) srt-23(yum2239) srt-24(yum2240) srt-59(yum2241) y55f3c.10(yum2242) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1207 |
C. elegans |
dcar-1(yum2244) pcdr-1(yum2245) d2023.1(yum2246) gtr-1(yum2247) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1208 |
C. elegans |
srw-33(yum2248) srw-34(yum2249) srw-35(yum2250) srw-36(yum2251) srw-38(yum2252) srw-39(yum2253) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1209 |
C. elegans |
f57g9.7(yum2254) r05f9.7(yum2255) c54c6.4(yum2256) r11g10.3(yum2257) f27e5.5(yum2258) f27e5.8(yum2259) t10g3.2(yum2260) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
FX30138 |
C. elegans |
tmC6 [dpy-2(tmIs1208)] II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Balancer marked with myo-2p::mCherry. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30167 |
C. elegans |
tmC18 [dpy-5(tmIs1200)] I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
GJ20 |
C. elegans |
dpy-20(e1282) IV; pkIs1201. Show Description
pkIs1201 [gpa-3::GFP + dpy-20(+)].
|
|
HS1204 |
C. elegans |
rmd-1&T05G5.9(tm1457) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are green and segregate green WT, dead eggs and nonGreens that lay dead eggs with the defects in spindle organization, chromosome segregation, and cytokinesis.
|
|
MS1206 |
C. elegans |
ceh-51(tm2123) V; irEx540. Show Description
irEx540 [ceh-51(+) + unc-119::CFP + rol-6(su1006)]. Throws arrested ceh-51(-) larvae, rescued animals expressing unc-119::CFP, and some unc-119::CFP-expressing larvae that are not rescued. Heterozygous mutant strain originally obtained from Shohei Mitani.
|
|
RG3332 |
C. elegans |
skpo-2(ve832[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. Show Description
tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Embryonic lethal. Deletion of 3081 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry dead eggs (ve832 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: GTGGGGAAAGATGCTAGACGGCTAGCTCCT; Right flanking sequence: AGGTCGTGGCGATCTTTGCAGGATTTGCTG. skpo-2 sgRNA #1: GGACTACAATGCCTGGAAAG; skpo-2 sgRNA #2: TCGAGGACCAGAATTTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RW12006 |
C. elegans |
unc-119(tm4063) III; stIs12006. Show Description
stIs12006 [ZC376.7a.1::H1-wCherry + unc-119(+)].
|
|
RW12009 |
C. elegans |
unc-119(tm4063) III; stIs12009. Show Description
stIs12009 [ZK662.4.1::H1-wCherry + unc-119(+)].
|
|
RW12011 |
C. elegans |
unc-119(tm4063) III; stIs12011. Show Description
stIs12011 [Y59A8B.13a::H1-wCherry + unc-119(+)].
|
|
RW12012 |
C. elegans |
unc-119(tm4063) III; stIs12012. Show Description
stIs12012 [F08C6.7::H1-wCherry + unc-119(+)].
|
|
RW12013 |
C. elegans |
unc-119(tm4063) III; stIs12013. Show Description
stIs12013 [Y48E1B.7.1::H1-wCherry + unc-119(+)].
|
|
RW12022 |
C. elegans |
unc-119(tm4063) III; stIs12022. Show Description
stIs12022 [ZK909.4::H1-wCherry + unc-119(+)].
|
|
RW12024 |
C. elegans |
unc-119(tm4063) III; stIs12024. Show Description
stIs12024 [ZK867.1c::H1-wCherry + unc-119(+)].
|
|
RW12061 |
C. elegans |
unc-119(tm4063) III; stIs12061. Show Description
stIs12061 [mxl-3::H1-wCherry + unc-119(+)].
|
|
RW12063 |
C. elegans |
unc-119(tm4063) III; stIs12063. Show Description
stIs12063 [Y5F2A.4::H1-wCherry + unc-119(+)].
|
|
RW12065 |
C. elegans |
unc-119(tm4063) III; stIs12065. Show Description
stIs12065 [B0414.2::H1-wCherry + unc-119(+)].
|
|
UDN100022 |
C. elegans |
rab-5(udn11)/tmC18 [dpy-5(tmIs1200)] I. Show Description
rab-5 [D135D]. Silent BstAPI site added in D135D allele for ease of genotyping. Balancer marked with myo-2p::Venus. Reference: Huang et al. 2022. PMID: 35121658
|
|
UDN100028 |
C. elegans |
rab-5(udn14)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Must be maintained at >20 degrees; grows better at 25C. Homozygous lethal rab-5 [D135H] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5[D135H] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent BstAPI site added in D135H for genotyping ease. Heterozygous rab-5[D135H] animals are small and have decreased locomotion. Reference: Huang et al. 2022. PMID: 35121658
|
|