More Fields
Strain Species Genotype
NM1081 C. elegans snb-1(js124)/dpy-11(e224) unc-68(r1158) V. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and L1 lethals. js124 homozygotes arrest as L1 larvae that are very uncoordinated and tend to adopt a coiled position. js124 molecular lesion is an amber mutation at codon 50.
NM1378 C. elegans unc-43(js125) V. Show Description
Unc. Maintain under normal conditions. Reference: Hawasli A, et al. Genetics. 2004 Oct;168(2):831-43.
NM1380 C. elegans egl-30(js126) I. Show Description
Suppresses unc-64(e246).
NM2040 C. elegans dhc-1(js121) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); jsIs37 V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Heterozygotes are GFP+ in the pharynx. dhc-1 homozygotes are GFP- and sterile or partially sterile pvuls. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP js121 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
NM4397 C. elegans jsIs973 III; ptrn-1(js1286) X. Show Description
jsIs973 [mec-7p::mRFP + unc-119(+)] III. Strong RFP cytosolic marker for mechanosensory neurons (Zheng et al. 2011, PMID 21115607).
OH1358 C. elegans kyIs123. Show Description
kyIs123 [trp-1::GFP].
OH1670 C. elegans him-5(e1490) V; otIs123. Show Description
otIs123 [sra-11::GFP + unc-4(+)]. Might contain an unc-4 mutation in the background.
OP120 C. elegans unc-119(ed3) III; wgIs120. Show Description
wgIs120 [ceh-30::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OP124 C. elegans unc-119(ed3) III; wgIs124. Show Description
wgIs124 [aha-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OP127 C. elegans unc-119(ed3) III; wgIs127. Show Description
wgIs127 [him-8::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OP129 C. elegans unc-119(ed3) III; wgIs129. Show Description
wgIs129 [sea-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OS122 C. elegans cfi-1(ky651) I. Show Description
OS12700 C. elegans unc-30(ns959[unc-30::GFP::degron]) IV. Show Description
Linker with GFP tag and degron inserted at the C terminus of the endogenous unc-30 locus. GFP expression in ASG, AVJ, DD, VD, and PVP neurons and GLR glia. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
OS9422 C. elegans igdb-2(ns122) IV. Show Description
Suppresses diI dye-filling phenotype in 37% of daf-6(e1377) mutants.
PD126 C. elegans unc-54(e190) I; ccIs126. Show Description
ccIs126 [myo-2p::lacZ + unc-54(+)]. lacZ expression in pharyngeal and body wall muscles. Superficially wild-type, but gives some paralyzed animals.
PD2557 C. elegans rps-10(cc2557)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus cc2557 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc2557 is an engineered mutation creating an early stop (T8*). Presumptive rps-10 null. Heterozygous rps-10(cc2557)/tmC20 animals are delayed in development. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
PD5994 C. elegans rps-23(cc5994)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by myo-2p::Venus-marked inversion. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus rps-23(cc5994) homozygotes (L1 arrest). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc5994 is an engineered mutation creating an early stop (A67*). Presumptive rps-23 null. Heterozygous rps-23(cc5994)/tmC5 animals are delayed in development. Check for proper segregation of progeny. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
PS1258 C. elegans sli-1(sy129) X. Show Description
Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1259 C. elegans sli-1(sy263) X. Show Description
Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4411 C. elegans unc-119(ed4) III; syIs123 X. Show Description
syIs123[unc-119(+) + fos-1a::YFP-TL]. Integration of functional fos-1a tagged with YFP at the N-terminus. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4444 C. elegans unc-119(ed4) syIs129 III. Show Description
syIs129 [hemicentin(delta SP)::GFP + unc-119(+)]. Integrant of hemicentin::GFP reporter where the signal has been deleted. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS7898 C. elegans C53C9.2(sy1116 sy1118)/tmC30 [ubc-17(tmIs1243)] X. Show Description
Superficially wild-type. a weak allele for C53C9.2 ; 58 bp insertion from downstream sequence of its own and 1 bp deletion (leading to change of an animo acid and insertion of 19 amino acids in frame); balanced with FX30326, further confimed by genotyping for homozygotes of C53C9.2 Left flanking sequence ACCGCTGTCGGTATGCCACGTTGGAATATCACCAAG; Right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATCTG; inserted sequence between the two flanking sequence: CTCGGAGAAGACATTCTCCGACGAGGAACCGAATTCACACCATGGTACTCTGGACAAA. sgRNA : GTATCCTTGCTTCTTGTCCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7911 C. elegans C53C9.2(sy1122)/tmC30[ubc-17(tmIs1243)] X. Show Description
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C53C9.2. lethal strain balanced with tmC30[ubc-17(tmIs1243)] X (from parental strain FX30236; dominant red pharynx and recessive Lon Mec); this strain segregates wild type, long animals, and L1 arrested homozygotes. Pick wild-type animals to maintain the heterozygotes. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGCTGTCGGTATGCCACGTTGGAATATCACCAAGG; right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).
RG3048 C. elegans M03F4.6(ve548[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC30[ubc-17(tmIs1243)] X. Show Description
tmIs1243 [myo-2p::mCherry, X: ubc-17] X. Homozygous lethal. Deletion of 2153 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, arrested GFP+ non-mCherry (ve548 homozygotes), and Lon Mec non-GFP mCherry+ (tmC30 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: TTTGACTTGTTTGTACCCGCATCTACATTG ; Right flanking sequence: ATCGGGAGTTTCTGCACACTGAGTTCATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3308 C. elegans C15H9.4(ve808[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC30 [ubc-17(tmIs1243)] X. Show Description
tmIs1243 [myo-2p::mCherry, X: ubc-17] X. Homozygous animals may be sensitive to starvation (grotty, low brood size). Deletion of 1634 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, wild-type GFP+ non-mCherry (ve808 homozygotes), and Lon Mec non-GFP mCherry+ (tmC30 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: TACTATATTCTGTTATTCCAAAATGCGTTT ; Right flanking sequence: ATAATGTGAACAGCACGCAAAACGGAACAA. sgRNA #1: GTTCCAGATGACAACAGACT; sgRNA #2: TGTCAAATCAGCTTTTTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3328 C. elegans nsun-1(ve828[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/lin-42(tmIs1226) II. Show Description
tmIs1266 [myo-2p::mCherry, II: lin-42] II. Homozygous larval arrest. Deletion of 1509 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+  arrested larvae (ve828 homozygotes) and mCherry+ animals [lin-42(tmIs1226) homozygotes]. Maintain by picking wild-type GFP+ mCherry+. Note from parent strain FX30266: Egl phenotype of lin-42 is not detectable. Left flanking Sequence: CAAAAACTGATTTTTCTGAAATCTAGTCCG; Right flanking sequence: GAGTACACGAGATATCCTGGAAAATTAGAT. nsun-1 sgRNA #1: ATGACGGTTTCAATACGGTA; nsun-1 sgRNA #2: CACGTGCTCTGTACTCGTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3332 C. elegans skpo-2(ve832[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. Show Description
tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Embryonic lethal. Deletion of 3081 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry dead eggs (ve832 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+.  Left flanking Sequence: GTGGGGAAAGATGCTAGACGGCTAGCTCCT; Right flanking sequence: AGGTCGTGGCGATCTTTGCAGGATTTGCTG. skpo-2 sgRNA #1: GGACTACAATGCCTGGAAAG; skpo-2 sgRNA #2: TCGAGGACCAGAATTTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RM3054 C. elegans snt-1(md290) II; mdIs126; mdIs129. Show Description
mdIs126 [snt-1p::snt-1(genomic; B-stop)::CFP]. mdIs129 [snt-1p::snt-1(genomic; A-stop)::YFP]. snt-1 mutation in genome is rescued by 2 integrated transgenes. snt-1(genomic; B-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6B; also referred to as "snt-1(A only)." snt-1(genomic; A-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6A; also referred to as "snt-1(B only)." Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.
RW12006 C. elegans unc-119(tm4063) III; stIs12006. Show Description
stIs12006 [ZC376.7a.1::H1-wCherry + unc-119(+)].
RW12009 C. elegans unc-119(tm4063) III; stIs12009. Show Description
stIs12009 [ZK662.4.1::H1-wCherry + unc-119(+)].
RW12011 C. elegans unc-119(tm4063) III; stIs12011. Show Description
stIs12011 [Y59A8B.13a::H1-wCherry + unc-119(+)].
RW12012 C. elegans unc-119(tm4063) III; stIs12012. Show Description
stIs12012 [F08C6.7::H1-wCherry + unc-119(+)].
RW12013 C. elegans unc-119(tm4063) III; stIs12013. Show Description
stIs12013 [Y48E1B.7.1::H1-wCherry + unc-119(+)].
RW12022 C. elegans unc-119(tm4063) III; stIs12022. Show Description
stIs12022 [ZK909.4::H1-wCherry + unc-119(+)].
RW12024 C. elegans unc-119(tm4063) III; stIs12024. Show Description
stIs12024 [ZK867.1c::H1-wCherry + unc-119(+)].
RW12061 C. elegans unc-119(tm4063) III; stIs12061. Show Description
stIs12061 [mxl-3::H1-wCherry + unc-119(+)].
RW12063 C. elegans unc-119(tm4063) III; stIs12063. Show Description
stIs12063 [Y5F2A.4::H1-wCherry + unc-119(+)].
RW12065 C. elegans unc-119(tm4063) III; stIs12065. Show Description
stIs12065 [B0414.2::H1-wCherry + unc-119(+)].
TH208 C. elegans unc-119(ed3) III; ddIs123. Show Description
ddIs123 [his-63::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH214 C. elegans unc-119(ed3) III; ddIs128. Show Description
ddIs128 [ify-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH215 C. elegans unc-119(ed3)III; ddIs129. Show Description
ddIs129 [klp-4::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TP193 C. elegans rips-1(ij109) V. Show Description
Resistance to strong reducing conditions: dithiothreitol (DTT) and 2- mercaptoethanol (2ME). Reference: Winter AD, et al. BMC Biol. 2022 Oct 8;20(1):228. doi: 10.1186/s12915-022-01415-y. PMID:36209095
TP390 C. elegans mce-1(ok243) I; rips-1(ij109) V. Show Description
mce-1(D2030.5). Strong resistance to reducing agents dithiothreitol (DTT) and 2- mercaptoethanol (2ME). Reference: Winter AD, et al. BMC Biol. 2022 Oct 8;20(1):228. doi: 10.1186/s12915-022-01415-y. PMID:36209095
TX1377 C. elegans unc-119(ed3) III; teIs127. Show Description
teIs127 [pie-1p::GFP::H2B::mom-2 3'UTR + unc-119(+)] teIs127 construct includes a 557 bp genomic sequence beginning 100 bp upstream of the mom-2 stop codon was cloned downstream of pie-1 promoter-driven GFP::H2B. Superficially wild-type. Reference: Oldenbroek M, et al. Development. 2013 Nov;140(22):4614-23.
UDN100022 C. elegans rab-5(udn11)/tmC18 [dpy-5(tmIs1200)] I. Show Description
rab-5 [D135D]. Silent BstAPI site added in D135D allele for ease of genotyping. Balancer marked with myo-2p::Venus. Reference: Huang et al. 2022. PMID: 35121658
UDN100028 C. elegans rab-5(udn14)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Must be maintained at 20 degrees. Homozygous lethal rab-5 [D135H] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5[D135H] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent BstAPI site added in D135H for genotyping ease. Heterozygous rab-5[D135H] animals are small and have decreased locomotion. Reference: Huang et al. 2022. PMID: 35121658
UDN100035 C. elegans rab-5(udn17)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Homozygous lethal rab-5 [Q78R] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78R] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent KpnI site added in Q78R for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658
UDN100037 C. elegans rab-5(udn15)/tmC18 [dpy-5(tmIs1200)] I. Show Description
rab-5 [Q78Q]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78Q] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn15 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [Q78Q] homozygotes from taking over the population and losing the balancer! Silent KpnI site added in Q78Q allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658
UDN100049 C. elegans let-413(udn27)/tmC3[egl-9(tmIs1230)] V. Show Description
let-413 [L248P]. Variant edit. Homozygous lethal or sterile deletion balanced by tmC3. Heterozygotes are wild-type mCherry+ and segregate mCherry+ heterozygotes, udn27 homozygotes (arrest stage unknown), and mCherry+ tmC3 homozygotes (Unc-23 Lon-3). Pick viable fertile mCherry+ animals to maintain. ApoI-HF restriction site created by synonymous changes for ease of genotyping.
UDN100103 C. elegans rab-5(udn49)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Homozygous lethal rab-5 [A29P] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29P] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent DdeI site added in A29P for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658