| XE3106 |
C. elegans |
pha-1(e2123) III; otIs707; wpEx525. Show Description
otIs707 [bnc-1p(1.8kb)::GFP]. wpEx525 [nlp-38p::NLS::TagRFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. GFP expression in VA neurons can be used to isolate VA by FACS (exclude TagRFP). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| XE3354 |
C. elegans |
unc-40(wp221) zdIs5 I. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. wp221 is a CRISPR-engineered deletion of unc-40 exon 14.5 near the splice sites of exons 14 and 15. mec-4p::GFP is expressed in touch neurons. Reference: Weinreb A, et al. Nat Commun. 2025 May 16;16:4508. doi: 10.1038/s41467-025-58293-5. PMID: 40379606.
|
|
| XF110 |
C. elegans |
polk-1(lf29) III. Show Description
Reference: Roerink SF, et al. PLoS Genet. 2012 Jun;8(6):e1002800.
|
|
| XF132 |
C. elegans |
polh-1(lf31) III. Show Description
Reference: Roerink SF, et al. PLoS Genet. 2012 Jun;8(6):e1002800.
|
|
| XF503 |
C. elegans |
lfIs129. Show Description
lfIs129 [elt-2p::GFP-HReporter + rol-6(su1004) + P(HS)::ISceI::mCherry]. Rollers. Reference: Roerink SF, et al. PLoS Genet. 2012 Jun;8(6):e1002800.
|
|
| XF86 |
C. elegans |
unc-119(ed3) III; pkIs2379 pkIs2170. Show Description
pkIs2170 [hsp-16.41::ATG-LacZ(first 251nt)-I-Sce-I site-stops-LacZ + unc-119(+)]. pkIs2379 [hsp-16.41::I-Sce-I ORF + rol-6(su1006)]. Reference: Pontier DB &Tijsterman M. Nat Methods. 2009 Sep;6(9):655-7.
|
|
| XIL9106 |
C. elegans |
bar-1(thu106[bar-1::2A::H1::mCherry]) X. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous bar-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9112 |
C. elegans |
mab-5(thu112[mab-5::2A::H1::mCherry]) III. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous mab-5 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9115 |
C. elegans |
Y56A3A.18(thu115[Y56A3A.18::2A::H1::mCherry]) III. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous Y56A3A.18 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9119 |
C. elegans |
sup-37(thu119[sup-37::2A::H1::mCherry]) V. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous sup-37 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9122 |
C. elegans |
ztf-14(thu120[ztf-14::2A::H1::mCherry]) X. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous ztf-14 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9126 |
C. elegans |
cbp-1(thu126[cbp-1::2A::H1::mCherry]) III. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous cbp-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9127 |
C. elegans |
nhr-67(thu127[nhr-67::LoxP::SL2::H1::mCherry::FLP::FRT::myo-2::GFP::Hyg::LoxP]) IV. Show Description
LoxP::SL2::H1::mCherry::FLP::FRT::myo-2::GFP::Hyg::LoxP was inserted at the 3' end of the endogenous nhr-67 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9129 |
C. elegans |
nhr-34(thu129[nhr-34::H1::mCherry]) IV. Show Description
H1::mCherry was inserted at the 3' end of the endogenous nhr-34 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9136 |
C. elegans |
ztf-7(thu136[ztf-7::2A::H1::mCherry]) V. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous ztf-7 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9137 |
C. elegans |
sma-3(thu137[sma-3::2A::H1::mCherry]) III. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous sma-3 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9138 |
C. elegans |
ceh-33(thu138[ceh-33::2A::H1::mCherry]) V. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous ceh-33 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9139 |
C. elegans |
F57C9.4(thu139[F57C9.4::2A::H1::mCherry]) I. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous F57C9.4 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9140 |
C. elegans |
F57A8.1(thu140[H1::GFP::2A::F57A8.1]) V. Show Description
H1::GFP::2A was inserted at the 5' end of the endogenous F57A8.1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9152 |
C. elegans |
saeg-2(thu152[saeg-2::2A::H1::mCherry]) X. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous saeg-2 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9164 |
C. elegans |
daf-3(thu164[daf-3::SL2::mCherry::H2B]) X. Show Description
SL2::mCherry::H2B was inserted at the 3' end of the endogenous daf-3 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9172 |
C. elegans |
Y53G8AR.9(thu172[pes-1::2A::NeonGreen::H2B]) III. Show Description
2A::NeonGreen::H2B was inserted at the 3' end of the endogenous pes-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9222 |
C. elegans |
hnd-1(thu22[H1::mCherry::2A::hnd-1]) X. Show Description
2A::H1::mCherry was inserted at the 5' end of the endogenous hnd-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL933 |
C. elegans |
Y53G8AR.9(thu33[Y53G8AR.9::mCherry]) III. Show Description
mCherry was inserted at the 3' end of the endogenous Y53G8AR.9 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL949 |
C. elegans |
tlp-1(thu49[tlp-1::SL2::H1::mCherry]) IV. Show Description
SL2::H1::mCherry was inserted at the 3' end of the endogenous tlp-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL99 |
C. elegans |
vab-15(thu9[vab-15::GFP]) X. Show Description
GFP was inserted at the 3' end of the endogenous vab-15 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XK194 |
C. elegans |
unc-46(e177) let-479(s1576) V/nT1 [qIs51] (IV;V). Show Description
|
|
| XM1002 |
C. elegans |
vab-1(dx31) III; itr-1(sy290) unc-24(e138) IV. Show Description
vab-1 null and itr-1 gain of function. Viable. Unc.
|
|
| XM1003 |
C. elegans |
nmr-1(ak4) II; fog-2(q71) V. Show Description
Negative regulator of oocyte maturation. Male/female strain.
|
|
| XM1007 |
C. elegans |
fog-3(q443) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); unc-43(n498) IV. Show Description
Heterozygotes are Unc with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous unc-43(n498); fog-3(q443) animals are females.
|
|
| XM1011 |
C. elegans |
inx-22(tm1661) I. Show Description
Negative regulator of oocyte maturation.
|
|
| XM1012 |
C. elegans |
inx-22(tm1661) I; fog-2(q71) V. Show Description
Negative regulator of oocyte maturation. Male/Female strain.
|
|
| XMN1253 |
C. elegans |
daf-15(bgg95) IV. Show Description
Maintain at 20C for best fecundity and most rapid development. Variable temperature-sensitive phenotypes. 20C: wild type; 22C: hypoxia resistant and long lifespan; 25C fully penetrant L3 developmental arrest. daf-15(bgg95) is an engineered I1033K missense mutation that also introduced three silent wobble mutations in nearby bases affecting restriction sites (cagGTTGCCCGAATGGCTCAAAAAATAGTGCAT -> cagGTGGCACGGATGGCTCAAAAAAAAGTGCAT). Strain can be genotyped by digest with either Bcc1 (silent wobble mutation generates additional cut in bgg95) or with Bgl1 (silent wobble mutation eliminates cut in bgg95). daf-15 crRNA: aucucgucagguugcccgaa. Repair ssODN: CATTTCGGGCATTCCTGCTTCGACGCGATGCACTTTTTTTTGAGCCATCCGTGCCACCTGACGAGATGTATTGGTTGTATTACACAGAC. Reference: Sun CL, et al. Curr Biol. 2025 Jun 9;35(11):2567-2582.e5. doi: 10.1016/j.cub.2025.04.040. PMID: 40339571.
|
|
| XR1 |
C. elegans |
abl-1(ok171) X. Show Description
1.5 kb of M79.1 locus is deleted which corresponds to the elimination of exons 8-12, including the kinase domain and 2/3 of the SH2 domains.
|
|
| XR2 |
C. elegans |
ced-3(n717) IV; abl-1(ok171) X. Show Description
|
|
| XR3 |
C. elegans |
lagr-1(gk327) I; hyl-1(ok976) IV. Show Description
|
|
| XR4 |
C. elegans |
lagr-1(gk327) I; hyl-1(ok976) IV; abl-1(ok171) X. Show Description
|
|
| XR5 |
C. elegans |
lagr-1(gk327) I; hyl-1(ok976) IV; ced-3(n717) IV. Show Description
|
|
| XR6 |
C. elegans |
lagr-1(gk327) I; opIs219. Show Description
opIs219 contains [ced-4p::ced-4::GFP].
|
|
| XR7 |
C. elegans |
gld-1(op236) I; hyl-1(ok976) IV. Show Description
|
|
| XT3 |
C. elegans |
cln-3.3(gk118) V. Show Description
Derived from VC146. Made as model for Batten disease. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XT4 |
C. elegans |
cln-3.3(gk118) cln-3.1(pk479) V. Show Description
Made as model for Batten disease. Derived from XT1 and XT3. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XT5 |
C. elegans |
cln-3.2(gk41) I; cln-3.1(pk479) V. Show Description
Made as model for Batten disease. Derived from XT1 and XT2. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XT6 |
C. elegans |
cln-3.2(gk41) I; cln-3.3(gk118) V. Show Description
Made as model for Batten disease. Derived from XT2 and XT3. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XT7 |
C. elegans |
cln-3.2(gk41) I; cln-3.3(gk118) cln-3.1(pk479) V. Show Description
Decreased brood size, mild life-span reduction. Made as model for Batten disease. Derived from XT2 and XT4. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XW13734 |
C. elegans |
unc-76(e911) V; qxIs612. Show Description
qxIs612 [hsp-16.2p::nuc-1::sfGFP::mCherry::unc-54 3'UTR + hsp-16.41p::nuc-1::sfGFP::mCherry::unc-54 3'UTR + unc-76(+)]. Heat-shock inducible NUC-1::sfGFP::mCherry fusion transgene for monitoring lysosomal activity. Array contains p76-16B, a plasmid containing 10.5 kb genomic DNA including unc-76. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5. doi: 10.1016/j.devcel.2019.10.020. PMID: 31735670.
|
|
| XW18042 |
C. elegans |
qxIs722 II. Show Description
qxIs722 [dpy-7p::dpy-7::SfGFP (single copy)]. qxIs722 is a single copy insertion into ttTi5605 via CRISPR/Cas9. DPY-7::SfGFP expression in cuticle over hyp7. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5.
|
|
| XW19180 |
C. elegans |
qxIs750. Show Description
qxIs750 [hsp-16.2p::nuc-1::pHTomato::unc-54 3'UTR + hsp-16.41p::nuc-1::pHTomato::unc-54 3'UTR + odr-1p::GFP]. Heat-shock inducible pHTomato transgene for monitoring lysosomal activity. Reference: Sun Y, et al. Elife. 2020 Jun 2:9:e55745. doi: 10.7554/eLife.55745. PMID: 32482227.
|
|
| XW5399 |
C. elegans |
unc-76(e911) V; qxIs257. Show Description
qxIs257 [ced-1p::nuc-1::mCherry + unc-76(+)]. Integrated nuc-1::mCherry transgene marking lysosomes in epidermal cells. Site of chromosomal integration unknown. Not known if unc-76(e911) is still present in background. Reference: Li Y, et al. J Cell Biol. 2016 Oct 24;215(2):167-185.
|
|
| XW8056 |
C. elegans |
unc-76(e911) V; qxIs430. Show Description
qxIs430 [scav-3::GFP + unc-76(+)]. Integrated GFP translational fusion transgene marking lysosomes in epithelial cells. Not known if unc-76(e911) is still present in background. Reference: Li Y, et al. J Cell Biol. 2016 Oct 24;215(2):167-185.
|
|