| VT3032 |
C. elegans |
mir-83(n4638) IV; mir-259(n4106) V. Show Description
DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3042 |
C. elegans |
nDf50 II; her-1(n695) V; nEx1187. Show Description
nEx1187 [mir-35 mir-45(genomic) + sur-5::GFP]. Pick GFP+ to maintain. Segregates GFP+ Egl animals carrying nEx1187 (mir-35 rescuing array) and GFP- animals that develop as XX pseudomales. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.
|
|
| VT3077 |
C. elegans |
nDf50/mIn1 [mIs14 dpy-10(e128)] II; sup-26(n1091) III; her-1(n695) V. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.
|
|
| VT3104 |
C. elegans |
maIs385 I; mir-34(gk437) X. Show Description
maIs385 [lim-7p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3105 |
C. elegans |
maIs386 I; mir-34(gk437) X. Show Description
maIs386 [myo-3p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3106 |
C. elegans |
maIs387 I; mir-34(gk437) X. Show Description
maIs387 [mir-34p::mir-34 + Cbr-unc-119(+)] I. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3107 |
C. elegans |
maIs388 II; mir-83(n4638) IV. Show Description
maIs388 [lim-7p::mir-83 + Cbr-unc-119(+)] II. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3108 |
C. elegans |
maIs389 II; mir-83(n4638) IV. Show Description
maIs389 [dpy-7p::mir-83 + Cbr-unc-119(+)] II. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3109 |
C. elegans |
maIs390 II; mir-83(n4638) IV. Show Description
maIs390 [myo-3p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3110 |
C. elegans |
maIs391 II; mir-83(n4638) IV. Show Description
maIs391 [mir-83p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3111 |
C. elegans |
maIs392 II; mir-83(n4638) IV. Show Description
maIs392 [lag-2p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3118 |
C. elegans |
unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3121 |
C. elegans |
sup-26(ma265 [sup-26::3xFLAG]) III. Show Description
Endogenous sup-26 locus tagged with 3xFLAG. Reference: McJunkin K & Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437. PMID: 28279983
|
|
| VT3123 |
C. elegans |
maIs396 I; mir-34(gk437) X. Show Description
maIs396 [dpy-7p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3124 |
C. elegans |
maIs397 I; mir-34(gk437) X. Show Description
maIs397 [lag-2p::mir-34 + Cbr-unc-119(+)] I. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3136 |
C. elegans |
unc-119(ed3) III; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3145 |
C. elegans |
unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3178 |
C. elegans |
unc-119(ed3) III; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3289 |
C. elegans |
mir-83(n4638) IV; mir-34(gk437) X. Show Description
DTC migration defects. Generated from VT3106 and VT3110. VC3289 has the genotype as VT2595 but made from different parental strains. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3294 |
C. elegans |
maIs387 I; maIs391 II; mir-83(n4638) IV; mir-34(gk437) X. Show Description
maIs387 [mir-34p::mir-34 + Cbr-unc-119(+)] I. maIs391 [mir-83p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT3297 |
C. elegans |
maIs105 V; mir-793(ma292) X. Show Description
maIs105 [col-19::GFP] V. mir-793(ma292) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma292 allele is missing the 220 nucleotide region between ACCGAGCAAGTTAGAAATCACCGCC and GTATGAATGTTTTTCCTTCAAACAT [chrX:13,857,855-13,858,124 of WBcel235/ce11].
|
|
| VT3299 |
C. elegans |
mir-795(ma298) I; maIs105 V. Show Description
maIs105 [col-19::GFP] V. mir-795(ma298) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma298 allele is missing the 5 nucleotides between CCGAGAAACGTTACCTGCT and AGATTGATCAGCGAGCTTGA [chrI:12,594,565-12,594,608 of WBcel235/ce11].
|
|
| VT3301 |
C. elegans |
mir-794 mir-795(maDf5) I. Show Description
mir-794 mir-795(maDf5) enhances retarded phenotypes of mir-48 mir-241 (nDF51). maDf5 allele is missing the 1312 nucleotide region between ATACATATTCCGAGAAACGTTACCT and GTGAGGCGCCAAATGCCGGCCTCAC [chrI:12,594,556-12,595,917 of WBcel235/ce11].
|
|
| VT333 |
C. elegans |
+/szT1 [lon-2(e678)] I; dpy-17(e164) III; dpy-6(e14) lin-14(n536) maDf2/szT1 X. Show Description
Heterozygotes are Dpy and segregate Dpy, males and dead eggs.
|
|
| VT3363 |
C. elegans |
nDf50/mIn1 [mIs14 dpy-10(e128)] II; nhl-2(ok818) III; her-1(n695) V. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.
|
|
| VT3500 |
C. elegans |
wIs51 V; hbl-1(ma354) X. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.
|
|
| VT3554 |
C. elegans |
nhl-2(ma371[gfp::3xFLAG::nhl-2]) III. Show Description
Endogenous nhl-2 locus tagged at the N-terminus with GFP and 3xFLAG. Reference: McJunkin K & Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437. PMID: 28279983
|
|
| VT3593 |
C. elegans |
lin-46(ma385) maIs105 V. Show Description
maIs105 [col-19::GFP]. Retarded heterochronic phenotypes: extra seam cells and alae gaps in young adults. ma385 is a 1681 bp deletion of the lin-46 gene. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
|
|
| VT3650 |
C. elegans |
lin-46(ma398[lin-46::mCherry]) V. Show Description
mCherry reporter inserted into C-terminus of endogenous lin-46 locus. Superficially wild-type. Fluorescent signal is very dim and bleaches very quickly. Reference: Ilbay O, et al. C. elegans LIN-28 controls temporal cell-fate progression by regulating LIN-46 expression via the 5UTR of lin-46 mRNA. bioRxiv 697490; doi: https://doi.org/10.1101/697490.
|
|
| VT3727 |
C. elegans |
lin-28(ma426[lin-28::GFP]) I. Show Description
GFP reporter inserted into C-terminus of endogenous lin-28 locus. Superficially wild-type. Reference: Ilbay O, et al. C. elegans LIN-28 controls temporal cell-fate progression by regulating LIN-46 expression via the 5UTR of lin-46 mRNA. bioRxiv 697490; doi: https://doi.org/10.1101/697490.
|
|
| VT3751 |
C. elegans |
maIs105 V; hbl-1(ma430[hbl-1::mScarlet-I]) X. Show Description
maIs105 [col-19::GFP] V. hbl-1(ma430) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1. Reference: Ilbay O & Ambros V. Curr Biol. 2019 Jun 3;29(11):1735-1745.e4.
|
|
| VT3805 |
C. elegans |
maIs105 V; alg-1(ma443) X. Show Description
Maintain at 20C. maIs105 [col-19::GFP] V. ma443 is a G199S substitution mimicking human AGO1 G199S mutation. Adult ma443 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
|
|
| VT3809 |
C. elegans |
alg-1(ma443) X. Show Description
Maintain at 20C. ma443 is a G199S substitution mimicking human AGO1 G199S mutation. Adult ma443 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
|
|
| VT3823 |
C.elegans |
maIs105 V; alg-1(ma447) X. Show Description
Maintain at 20C. maIs105 [col-19::GFP] V. ma447 is a F180(deletion) mimicking human AGO1 F180 mutation. Adult ma447 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
|
|
| VT3824 |
C. elegans |
alg-1(ma447) X. Show Description
Maintain at 20C. ma447 is a F180(deletion) mimicking human AGO1 F180 mutation. Adult ma447 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
|
|
| VT3855 |
C. elegans |
lin-46(ma467) maIs105 V. Show Description
maIs105 [col-19::GFP]. Precocious heterochronic phenotypes: fewer seam cells and protruding vulva in young adults and patches of alae in L4 larvae. ma467 is a 12 bp deletion in the 5'UTR of the lin-46 gene, which results in gain-of-function of lin-46. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
|
|
| VT3869 |
C. elegans |
wIs51 V; hbl-1(ma430ma475[hbl-1::mScarlet-I::partial deletion of hbl-1 3'UTR]) X Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Retarded Heterochronic defects: extra seam cells and partial or no alae in young adults. hbl-1(ma430ma475) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1 and part of the 3' UTR removed. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
|
|
| VT3922 |
C. elegans |
lin-28(n719) I; daf-12(ma497[daf-12::gfp]) hbl-1(ma430[hbl-1::mScarlet-I]) X. Show Description
Precocious heterochronic phenotypes as preciously reported for lin-28(n719). Endogenous daf-12 locus tagged with GFP. hbl-1(ma430) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
|
|
| VT3923 |
C. elegans |
maIs105 V; daf-12(ma498[daf-12::mScarlet-I]) X. Show Description
maIs105 [col-19p::GFP] V. mScarlet-I tag inserted at C-terminus of endogenous daf-12 locus through CRISPR/Cas9-engineering. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.
|
|
| VT454 |
C. elegans |
maDf4/dpy-10(e128) unc-104(e1265) II. Show Description
Heterozygotes are WT (slightly Dpy) and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
|
|
| VT509 |
C. elegans |
lin-4(e912) II; maEx114. Show Description
maEx114 [lin-4(+) + rol-6(su1006)]. Pick Rollers to maintain. lin-4 loss-of-function is rescued by the maEx114 extrachromosomal array expressing lin-4 microRNA. Reference: Lee RC, et al. Cell. 75, 843-854.
|
|
| VT516 |
C. elegans |
lin-29(n546)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are slightly shorter than WT and segregate DpyUnc and Egl.
|
|
| VT573 |
C. elegans |
lin-4(e912) II; lin-14(n179) X. Show Description
lin-14(n179) is temperature-sensitive. lin-4; lin-14 double mutant may be maintained at 20C.
|
|
| VT581 |
C. elegans |
dpy-5(e61) lin-28(n719) I; lin-46(ma164) unc-76(e911) V. Show Description
Dpy Unc. Egl+. lin-46 suppresses precocious Egl- phenotype of lin-28. lin-46 alone makes gaps in adult alae; enhanced at 15C.
|
|
| VT592 |
C. elegans |
lin-28(n719) lin-10(n1390) I. Show Description
Vul.
|
|
| VT664 |
C. elegans |
lin-28(n719) I; nIs2 IV. Show Description
nIs2 [lin-11::lacZ + lin-11(+)] IV. Egl. Integrated on IV near dpy-20.
|
|
| VT723 |
C. elegans |
lin-28(n719) I; lin-3(e1417) IV. Show Description
Egl. Vulvaless due to lin-3. Precocious VPC divisions and adult alae due to lin-28.
|
|
| VT733 |
C. remanei ssp. vulgaris |
Show Description
Male-female strain. Reference WBG 11(4):89. See also WBPaper00001874. May crawl off the plates. Isolated by Bill Fixsen at a rest area on the turnpike in Conn. Previously called WS9-6 and C. vulgaris NH and C. vulgariensis by the CGC. Walter Sudhaus has tentatively described this strain as C. remanei ssp. vulgaris; this description is not official and is contigent upon its being published. See WBPaper00002633.
|
|
| VT757 |
C. elegans |
lin-28(n719) I; lin-12(n137n460) III. Show Description
Only gives a decent brood size at 20C. At 15C: Muv/Blip. At 20C: some Muv/Blip, some Blip but not Muv. At 25C: Not Muv, but do have Blip (due to lin-12). Egl- at all temps.
|
|
| VT765 |
C. elegans |
unc-36(e251) III; maIs103. Show Description
maIs103 [rnr::GFP + unc-36(+)].
|
|