Homozygous viable. Deletion of 1991 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TACGATGGAACCATCACCAGACGGTCAACT; Right flanking sequence: TTTTCTCATTTTTCTCATCGTCGATGCATT. sgRNA #1: CGAGATAATCGCAAATTCAG; sgRNA #2: CCACATATGTTATCAAATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3115 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAGTGGACGGTTTTGTGGGCATAATGCAT; Right flanking sequence: CCACTCCCCTTTTTCGGAAATTGGAAAACG. sgRNA #1: CACATTTCACGCACAGAAGA; sgRNA #2: TGAACGAAAGATTAACGGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7157 and CGC66. hd7157 is a 1439 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AATTTGATAATCTCTTGAGCAGCTATTCCA; Right flanking sequence: GTTGGTGGCTGACTACTTGCACTACCAGAG. sgRNA #1: CCGACGTACGATGAAATGAC; sgRNA #2: CATCTTCCATAGCTAACGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion balanced with tmC25. Maintain by picking wild-type GFP+. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7151 and FX30257. hd7151 is a deletion of 435 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCCGATAAAGTTGTGACGCCCTTTGCCA; Right flanking sequence: TGTCGATCTTCCTTGTTTTTTGTTGAAAAA. sgRNA #1: AAACTTACTCAGATATGCTC; sgRNA #2: CAAAAACTAGCTAGAAATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1790 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAGGCCTCCAGTAGATGCTCCAGGAGCCG; Right flanking sequence: CGGGATGCGATACACGAAAACCTTGGGTTT. sgRNA #1: TGCAGTTTCCCGCCCTCGTC; sgRNA #2: TGACCGCTGGTTCCGATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3555 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAACTGTGGATAGAATTAGGGGTGGACGAA; Right flanking sequence: AATATAGTATTATAGGACCGAAAATATAGA. sgRNA #1: AAACGATTTACTCCGGCTAT; sgRNA #2: CAAAAAATTAGCGTCTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAACTTCTGGACAACCGGCAGAAACGCCA; Right flanking sequence: GTAGGCACAAAGAAGGCGTAGGCCTCCTGG. sgRNA #1: TGGCGTTTCAGAGCTGCACG; sgRNA #2: AAAGCCAATTGTCTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 969 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAGACCTTGAACAATCTTCCATTCGCCA; Right flanking sequence: CGGACATTCTGAAAATTTAGCAATTTACAC. sgRNA #1: TTCCCAGTTACCATCGAGGG; sgRNA #2: GACCAAAACGCGAAGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2415 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAACTTTCTCGGAGTTATCCCCTTCGATTT; Right flanking sequence: GGGAGAGGAGTAGGTCCCGGTGGTAAATTT. sgRNA #1: GTCGAGCGATGGAAGACCGG; sgRNA #2: GGAGAGTATTGCCGAACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 911 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAATGTTGAAAATAAAAGTGAAAAACTCT; Right flanking sequence: TGGAATTGGATATTTTTGCCACTTTTAATC. sgRNA #1: GTTGGTGTGGTTTTGCGTGG; sgRNA #2: TTTCTCTCCCGTAAACCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7170 and CGC63. hd7170 is a 966 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CAGAAAGAGCCTTCTCGACACGATTTTCCG; Right flanking sequence: TTCGAAAGTGGCAATCAGGAACTCTAACGA. sgRNA #1: AATGGTTACCTGCTGCGACG; sgRNA #2: GGTTGGGCAATACTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 6488 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAAGCCGAGATTACAAAGAATATGATGA; Right flanking sequence: GACCTTTTATAACTATTCACCCATACTAAT. sgRNA #1: AAGACGAGTCGGCACAGTTG; sgRNA #2: GTGAAGTTGTTATTGTACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2058 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTAAAAACTTTAATAGATACATTTTTGGC; Right flanking sequence: ATACGCTTCTACAATACAACAATCGTTGAA. sgRNA #1: AAAATTACGCCAAACCTGCT; sgRNA #2: ACATTTGAATTATGTTGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 512 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTACTTTCAGGCCCAAATGTGGAAATTGCG; Right flanking sequence: ACTATATGTGACATTTTGAAGAAGTAATAT. sgRNA #1: GCCTCAAGTACAAGCCTACT; sgRNA #2: TGAATAGTTGATTGGCACCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCTGTGCAGATCCAACTAGGGCGTCTCCA; Right flanking sequence: AGGAAATTTTTGTCGAAAATTCTGAAAAAT. sgRNA #1: CATGGTATGGATGGAAGCAT; sgRNA #2: CAAAGTTAGCAATTTTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7175 and CGC63. hd7175 is a 1325 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCCAAAAAATCAATATCTTCACCATTTTCA; Right flanking sequence: TGGAGCTACAAAATTCGCCGATTTTGAAAA. sgRNA #1: GACTTTCCTACGCAACACCA; sgRNA #2: ATTCTCTTCGCAGATGCCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7177 and CGC92. hd7177 is a 7087 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GATGGTCCATTTGTATTAGTTGTTGTACCA; Right flanking sequence: TTTTAGTTGGAACGGCTCGCGCCCAAGCAG. sgRNA #1: CTTGGCTGTGATGATTGACC; sgRNA #2: AAACGGAACAAGGACACGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7180 and CGC66. hd7180 is a 1876 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCTTTTTACAGATTTAATAACACCAAAT; Right flanking sequence: TGGCTACAAATACCTTGAAATTGTTATTCG. sgRNA #1: GGCCCAATACGCCCTGGAGG; sgRNA #2: GACATGCTCTCTAATCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking viable fertile wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced with hln1. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ homozygotes, and Unc homozygotes. Derived from parental strains VH7178 and PS1056. hd7179 is a deletion of 12118 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGGGCGAGGTAACGGGCGAATATTGCCG; Right flanking sequence: AACTGATTCTCAGTTAACCTAACCAATGAT. sgRNA #1: CAAACCCCGTACTTTTCAGG; sgRNA #2: AAGAAGTCGGGCTACTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7181 and CGC66. hd7181 is a 1382 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ACTTCCTGCACCCAGAACTCATCAATTCCA; Right flanking sequence: AGCCATGCTAGAATTTCCTTTGGGTCCCCA. sgRNA #1: TCACTACTATTTACTCCACG; sgRNA #2: GGAAGTCTTGCATTAGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ homozygotes and paralysed DpyUnc mKate2+ mnC1 homozygotes. Derived from parental strains VH7182 and CGC48. hd7182 is a 1757 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCACAACTCTGTGGAATATCCATTTCAC; Right flanking sequence: ATAGCTTCTTCGCTTATTTTTCCAGACATC. sgRNA #1: ACGCTCGAATCGCAAACTGG; sgRNA #2: GCAGGAACAGGCCGAAAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

hdEx231 [C16C10.10::GFP + pha-1(+)]. Ubiquitous expression of glyoxalase-1::GFP. Maintain at 25 C. Reference: Morcos M et al. (2008) Aging Cell 7(2):260-9.

F10G7.2. External left primer: AGAACTTTGTCGGATCGATTGT. External right primer: TCTCCGTACTCCCAAATGTTCT. Internal left primer: AAAGAGACTTCGCTTGTGGAAG. Internal right primer: ACCTTCTTGTTTCCACTGTCGT. Internal WT amplicon: 1729 bp. Deletion size: 878 bp. Deletion left flank: AACAACTTTATAAAATTGTATTTTTTTTTT. Deletion right flank: ACGTCCAACTCACTTCTGATGCTTTCGCCC. This strain was provided by the Hutter Lab at Simon Fraser University (Burnaby, BC), which should be acknowledged in any publications resulting from its use.

pmcIs1 [ant-1.1p::ant-1.1::GFP + unc-119(+)]. Expression of ant-1.1::GFP under ant-1.1 promotor (Farina et al., Dev Dyn 2008) in most tissues including the gonads and in the spermatozoa. GFP intensity is low and unstable. GFP positive worms should be selected under fluorescence microscope. ant-1.1::GFP expression seems to be more stable when worms are grown at 24°C and in the dark. Reference: Al Rawi S, et al. Science. 2011 Nov 25;334(6059):1144-7.

Heterozygotes are WT and segregate WT, DpyUncs, and erm-1 homozygotes which grow up to bagging adults with few progeny. Some of these hatch but die as L1s.

Animals which have lost the Dp grow up to bagging adults with few progeny. Some of these hatch but die as L1s.

vkEx1093 [nhx-2p::mCherry::lgg-1]. Maintain by picking mCherry+ animals. Increased puncta under autophagy conditions. Reference: Gosai SJ, et al. PLoS One. 2010 Nov 12;5(11):e15460.

vkEx1104 [nhx-2p::YFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vkEx1241 [nhx-2p::mCherry::lgg-1 + myo-2p::GFP]. Diffuse mCherry expression in intestine. GFP+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vkEx1243 [nhx-2p::ubiquitin-V::mCherry + myo-2p::GFP]. Increased Ub-tagged mCherry accumulation upon blockage of the proteosome by RNAi. Faint mCherry expression in intestine. GFP+ pharynx. References: Miedel MT, et al. PLoS One. 2012;7(7):e40145. Gosai SJ, et al. PLoS One. 2010 Nov 12;5(11):e15460. Dantuma NP, et al. Nat Biotechnol. 2000 May;18(5):538-43.

vkEx1244 [nhx-2p::ubiquitin-Met::mCherry + myo-2p::GFP]. mCherry behaves as an umodified cytosolic protein upon ubiquitin cleavage due to the absence of a degredation signal (N-terminal methionine). Diffuse mCherry expression in intestine. GFP+ pharynx. References: Miedel MT, et al. PLoS One. 2012;7(7):e40145. Gosai SJ, et al. PLoS One. 2010 Nov 12;5(11):e15460. Dantuma NP, et al. Nat Biotechnol. 2000 May;18(5):538-43.

vkEx1256 [nhx-2p::cpl-1::YFP + nhx-2p::DsRed::KDEL]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vkEx1258 [nhx-2p::cpl-1(W32AY35A)::YFP + nhx-2p::DsRed::KDEL]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vkEx1260 [nhx-2p::cpl-1::YFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vkEx1770 [nhx-2p::F13D12.6::YFP + nhx-2p::DsRed::KDEL]. YFP+ intestine. Reticular dsRed expression in intestine. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vkEx1870 [nhx-2p::F13D12.6(G166R)::YFP + myo-2p::mCherry]. YFP+ intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vkEx1879 [nhx-2p::cpl-1(W32A Y35A)::YFP + myo-2p::mCherry]. YFP+ accumulation in intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vkEx1879 [nhx-2p::cpl-1(W32A Y35A)::YFP + myo-2p::mCherry]. YFP+ accumulation in intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

vkEx2620 [nhx-2p::aman-2::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing AMAN-2::CemOrange2 under the intestinal-specific nhx-2 promoter. AMAN-2 is localized to the Golgi. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2664 [nhx-2p::CemOrange2::tram-1 + myo-2p::GFP]. Wild-type animals expressing CemOrange2::TRAM-1 under the intestinal-specific nhx-2 promoter. TRAM-1 is localized to the ER. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2666 [nhx-2p::CemOrange2::rab-7 + myo-2p::GFP]. Wild-type animals expressing CemOrange2::RAB-7 under the intestinal-specific nhx-2 promoter. RAB-7 is localized to the late endosome. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2671 [nhx-2p::CemOrange2::rab-5 + myo-2p::GFP]. Wild-type animals expressing CemOrange2::RAB-5 under the intestinal-specific nhx-2 promoter. RAB-5 is localized to the late endosome. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2674 [nhx-2p::CemOrange2::pisy-1 + myo-2p::GFP]. Wild-type animals expressing CemOrange2::PISY-1 under the intestinal-specific nhx-2 promoter. PISY-1 is localized to the ER. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2688 [nhx-2p::CemOrange2::cup-5 + myo-2p::GFP]. Wild-type animals expressing CemOrange2::CUP-5 under the intestinal-specific nhx-2 promoter. CUP-5 is localized to the lysosome. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkIs2697 [nhx-2p::lmp-1::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing LMP-1::CemOrange2 under the intestinal-specific nhx-2 promoter. LMP-1 is localized to the lysosome. Integrated; chromosome unknown. Reference: Thomas

vkEx2700 [nhx-2p::CemOrange2::SKL + myo-2p::GFP]. Wild-type animals expressing CemOrange2::SKL under the intestinal-specific nhx-2 promoter. The SKL motif (signal peptide) localizes to the peroxisome. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2702 [nhx-2p::mtCemOrange2 + myo-2p::GFP]. Wild-type animals expressing MT::CemOrange2 under the intestinal-specific nhx-2 promoter. The MT motif (signal peptide) localizes to the mitochondria. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2728 [nhx-2p::sqst-1::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing SQST-1::CemOrange2 under the intestinal-specific nhx-2 promoter. SQST-1 is localized to the autophagasome. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2733 [nhx-2p::NLS-SV40::CemOrange2::NLSegl-13 + myo-2p::GFP]. Wild-type animals expressing NLS(sv-40)::CemOrange2::NLS(egl-13) under the intestinal-specific nhx-2 promoter. The dual NLS localizes to the nucleus. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkIs2734 [nhx-2p::lmn-1::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing LMN-1::CemOrange2 under the intestinal-specific nhx-2 promoter. LMN-1 is localized to the nuclear lamin. Integrated; chromosome unknown. Reference: Thomas