More Fields
Strain Species Genotype
VT1143 C. elegans lin-41(ma104) I; nDf51 V; mir-84(n4037) X. Show Description
Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1145 C. elegans lin-46(ma164) nDf51 V; mir-84(n4037) X. Show Description
Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. Vul. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1146 C. elegans nDf51 V; hbl-1(ve18) mir-84(n4037) X. Show Description
Weak retarded heterochronic phenotype with incomplete alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1153 C. elegans unc-119(ed3) III; maIs137. Show Description
maIs137 [let-7p::GFP + unc-119(+)]. Wild type.
VT1160 C. elegans unc-119(ed3) III; maIs138. Show Description
maIs138 [mir-84p::GFP + unc-119(+)]. Wild type.
VT1189 C. elegans unc-119(ed3) III; maIs140. Show Description
maIs140 [mir-241p::GFP + unc-119(+)]. Wild type.
VT1259 C. elegans unc-119(ed3) III; maIs150. Show Description
maIs150 [mir-48p::GFP + unc-119(+)]. Wild type.
VT1289 C. elegans mir-63(n4568) X. Show Description
Deletion breakpoints are: TAAAAATTCAAAGAATTGATATCTGAACA / CTACTATGCCACC...CCAAAGGGGTGG / TTTTCAACAATTTCACCACTGGCGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT132 C. elegans sqt-1(sc13) lin-29(n333)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are slightly shorter than WT and segregate more animals which are slightly shorter than WT, Rollers which are Egl and have a protruding vulva, and DpyUncs.
VT1343 C. elegans flh-1(bc374) IV. Show Description
VT1361 C. elegans mir-2(n4108) I. Show Description
Deletion breakpoints are:TCAAAAAAAAACTTCAAT / ATTTTTATGGTATCTTAC...CGAATCTCTTCAAGCAAT / TGGTACTATCTCGATGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT1362 C. elegans mir-70(n4109) V. Show Description
Deletion breakpoints are: ATTCATATTTCGATTAATAAAATTACCAAACA / CAATCCAACATAA...ATGGATACGCAGTA / AGAACAATATATGAACGATCGAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT1376 C. elegans flh-2(bc375) III. Show Description
VT1379 C. elegans unc-119(ed3) III; maIs162. Show Description
maIs162 [mir-59p::GFP + unc-119(+)]. Wild type.
VT1380 C. elegans unc-119(ed3) III; maIs163. Show Description
maIs163 [mir-357-358p::GFP + unc-119(+)]. Wild type. [10/01/2018: Received new stock from VT following report from user that GFP expression pattern in original stock was not as expected.]
VT1470 C. elegans unc-119(ed3) III; maIs173. Show Description
maIs173 [mir-242p::GFP + unc-119(+)]. Wild type.
VT1474 C. elegans unc-119(ed3) III; maIs177. Show Description
maIs177 [mir-243p::GFP + unc-119(+)]. Wild type.
VT1477 C. elegans unc-119(ed3) III; maIs180. Show Description
maIs180 [mir-244p::GFP + unc-119(+)]. Wild type.
VT1479 C. elegans unc-119(ed3) III; maIs182. Show Description
maIs182 [mir-251p::GFP + unc-119(+)]. Wild type.
VT1481 C. elegans unc-119(ed3) III; maIs184. Show Description
maIs184 [mir-51::GFP + unc-119(+)]. Wild type.
VT1482 C. elegans unc-119(ed3) III; maIs185. Show Description
maIs185 [mir-2p::GFP + unc-119(+)]. Wild type.
VT1485 C. elegans unc-119(ed3) III; maIs188. Show Description
maIs188 [mir-228p::GFP + unc-119(+)]. Wild type.
VT1486 C. elegans unc-119(ed3) III; maIs189. Show Description
maIs189 [mir-54-56p::GFP + unc-119(+)]. Wild type.
VT1488 C. elegans unc-119(ed3) III; maIs191. Show Description
maIs191 [mir-235p::GFP + unc-119(+)]. Wild type.
VT1492 C. elegans unc-119(ed3) III; maIs196. Show Description
maIs196 [mir-227-80p::GFP + unc-119(+)]. Wild type.
VT1494 C. elegans unc-119(ed3) III; maIs197. Show Description
maIs197 [mir-234p::GFP + unc-119(+)]. Wild type.
VT1503 C. elegans unc-119(ed3) III; maIs206. Show Description
maIs206 [mir-81p::GFP + unc-119(+)]. Wild type.
VT1539 C. elegans unc-119(ed3) III; maIs218. Show Description
maIs218 [mir-231p::GFP + unc-119(+)]. Wild type.
VT1541 C. elegans unc-119(ed3) III; maIs220. Show Description
maIs220 [mir-360p::GFP + unc-119(+)]. Wild type.
VT1555 C. elegans mir-59(n4604) IV. Show Description
Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT1598 C. elegans unc-119(ed3) III; maIs227. Show Description
maIs227 [mir-90p::GFP + unc-119(+)]. Wild type.
VT1600 C. elegans unc-119(ed3) III; maIs229. Show Description
maIs229 [mir-85p::GFP + unc-119(+)]. Wild type.
VT1605 C. elegans unc-119(ed3) III; maIs234. Show Description
maIs234 [mir-53::GFP + unc-119(+)]. Wild type.
VT1607 C. elegans unc-119(ed3) III; maIs236. Show Description
maIs236 [mir-246p::GFP + unc-119(+)]. Wild type.
VT1665 C. elegans unc-119(ed3) III; maIs251. Show Description
maIs251 [mir-1p::GFP + unc-119(+)]. Wild type.
VT1673 C. elegans unc-119(ed3) III; maIs256. Show Description
maIs256 [mir-247-797p::GFP + unc-119(+)]. Wild type.
VT1702 C. elegans unc-119(ed3) III; maIs261. Show Description
maIs261 [mir-265p::GFP + unc-119(+)] Wild type.
VT1709 C. elegans unc-119(ed3) III; maIs267. Show Description
maIs267 [mir-266p::GFP + unc-119(+)]. Wild type.
VT1710 C. elegans unc-119(ed3) III; maIs268. Show Description
maIs268 [mir-259p::GFP + unc-119(+)]. Wild type.
VT1733 C. elegans unc-119(ed3) III; maIs276. Show Description
maIs276 [mir-60p::GFP + unc-119(+)]. Wild type.
VT1735 C. elegans unc-119(ed3) III; maIs278. Show Description
maIs278 [mir-788p::GFP + unc-119(+)]. Wild type.
VT1842 C. elegans unc-119(ed3) III; maIs300. Show Description
maIs300 [mir-82p::GFP + unc-119(+)]. Wild type.
VT1891 C. elegans flh-3(tm3024) IV. Show Description
tm3024 deletion was generated by S. Mitani. Outcrossing was performed by M. Ow.
VT191 C. elegans +/szT1 [lon-2(e678)] I; dpy-6(e14) lin-14(n536) maDf1/szT1 X. Show Description
VT192 C. elegans +/szT1 [lon-2(e678)] I; dpy-6(e14) lin-14(n536) maDf2/szT1 X. Show Description
VT2020 C. elegans unc-119(ed3) III; maIs347. Show Description
maIs347 [mir-793p::GFP + unc-119(+)]. Wild type.
VT2021 C. elegans unc-119(ed3) III; maIs348. Show Description
maIs348 [mir-794p::GFP + unc-119(+)]. Wild type.
VT2084 C. elegans unc-119(ed3) III; maIs352. Show Description
maIs352 [mir-71p::GFP + unc-119(+)]. Wild type.
VT2392 C. elegans mir-34(gk437) X. Show Description
DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT2527 C. elegans mir-124(n4255) IV. Show Description
Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.