More Fields
Strain Species Genotype
VC977 C. elegans his-69(gk394) III. Show Description
E03A3.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC978 C. elegans set-31(ok1482) V. Show Description
C15H11.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC979 C. elegans F18A12(gk911) II. Show Description
F18A12. External left primer: TAGTCGGCGCTTCAGGTACT. External right primer: CTGGGCTCTTTACTTCCGTG. Internal left primer: TTTCATGGCTTCTATCCGCT. Internal right primer: TTATCTGGAATCGGCTTTGG. Internal WT amplicon: 1859 bp. Deletion size: 721 bp. Deletion left flank: AATAAGGAAACATACCCGAAAAACTCGAGG. Deletion right flank: AAAAAATGGGGTTTTAATATTGTTTTTATA. Insertion Sequence: AAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC980 C. elegans fsn-1(gk429) III. Show Description
C26E6.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC983 C. elegans hda-2(ok1479) II. Show Description
C08B11.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC984 C. elegans rpn-9(gk401)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T06D8.8. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk401 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC985 C. elegans vps-54(ok1463) V. Show Description
T21C9.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC986 C. elegans vps-54(ok1473) V. Show Description
T21C9.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC987 C. elegans egas-2(ok1480) V. Show Description
Y69H2.12. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC988 C. elegans ceh-60(ok1485) X. Show Description
F22A3.5. Superficially wild type. External left primer: TATGGCGGTTCAAAATGTCA. External right primer: AAAGGTGAAGGTCACATCCG. Internal left primer: TCGAATTTTGCCCAGTTTTC. Internal right primer: TTCAGGCTCTCGGATGAACT. Internal WT amplicon: 2621 bp. Deletion size: 612 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC989 C. elegans gut-2(gk402)/+ V. Show Description
T10G3.6. Heterozygous strain. Homozygote is Pvl and sterile. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC990 C. elegans cnb-1(ok276) V. Show Description
F55C10.1. Slow-growing with small broods. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC992 C. elegans spv-1(ok1498) II. Show Description
ZK669.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC993 C. elegans gly-5(gk406) III. Show Description
Y39E4B.12a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC994 C. elegans inx-9(ok1502) IV. Show Description
ZK792.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC995 C. elegans ceh-12(gk391) I. Show Description
F33D11.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC996 C. elegans pas-5(ok1808) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F25H2.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1808 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGAGTGTTCACAAACCCAA. External right primer: TGGATTCTTTCCGAGGTGTC. Internal left primer: GCTCTGTCACCTCGAAGACC. Internal right primer: GCGGACGTATTGAATGTGTG. Internal WT amplicon: 2116 bp. Deletion size: 880 bp. Deletion left flank: GAGTACGATCGTGGAGTCAACACTTTTTCT. Deletion right flank: TTATTTGTCGTTCTTTTATACATTTTTGAA. Insertion Sequence: AAAAAATAGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC997 C. elegans set-4(ok1481) II. Show Description
C32D5.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC998 C. elegans dnj-7(ok1495) X. Show Description
C55B6.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC999 C. elegans tag-340(ok1496) III. Show Description
F26F4.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VF1 C. elegans unc-119(ed3) III; gfEx1. Show Description
gfEx1 [hmt-1p::GFP + unc-119(+)]. Maintain under normal conditions. GFP expression detected in Intestinal cells, terminal pharyngeal bulb, coelomocytes, and head & tail neurons. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
VF14 C. elegans arIs37 I; unc-119(ed3) hmt-1(gk161) III; cdIs32. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cdIs32 [unc-122p::DT-A(E148D) + myo-2p::GFP + unc-119(+)]. Hypersensitive to cadmium. Lacks coelomocytes and accumulates GFP in pseudocoelome. Maintain under normal conditions. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
VF2 C. elegans pcs-1(tm1748) II. Show Description
Hypersensitive to cadmium. Maintain under normal conditions. 588 bp deletion + 3 bp insertion [36918/36919 - AAA - 37506/37507]. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
VF3 C. elegans hmt-1(gk161) III. Show Description
Hypersensitive to cadmium; refractile inclusions in intestinal cells on Cd plates. Maintain under normal conditions. 2,149 bp deletion encompasses exons 5, 6 & 7; introduces premature stop codon. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
VF8 C. elegans hmt-1(gk155) III. Show Description
Hypersensitive to cadmium; refractile inclusions in intestinal cells on Cd plates. Maintain under normal conditions. 416 bp deletion encompasses exon 1; in-frame Met present in second exon. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
VF9 C. elegans pcs-1(tm1748) II; hmt-1(gk161) III. Show Description
Acute hypersensitivity to heavy metals (Cd, As, Cu). Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
VH1075 C. elegans rhIs4 hdIs26 III; fmi-1(rh308) V. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdIs26 [odr-2p::CFP + sra-6p::DsRed2] III. Ventral cord cross-over defects. PVQ axons sometimes stop short or leave the ventral cord. Reference: Steimel A, et al. Development. 2010 Nov;137(21):3663-73.
VH1160 C. elegans ast-1(hd92) II; rhIs4 III; hdEx237. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdEx237 [ast-1(+) + rol-6(su1006)]. hd92 arrests as L1 due to pharyngeal differentiation defects; ventral cord midline crossing defects; rescued with ast-1(+) transgene. Rollers.
VH1195 C. elegans hdIs42. Show Description
hdIs42[ast-1::YFP + rol-6(su1006)]. GFP expression in neurons; contains full length AST-1 tagged with GFP at the C terminus. Rollers.
VH1312 C. elegans nas-6(hd108) IV. Show Description
Slow growth. Reduced rate of pumping and abnormal morphology of the grinder in pharynx. Reference: Park JO, et al. BMC Dev Biol. 2010 Jan 28;10:14.
VH1348 C. elegans nas-7(hd116) II. Show Description
Superficially wild-type. Reference: Park JO, et al. BMC Dev Biol. 2010 Jan 28;10:14.
VH1565 C. elegans rhIs4 hdIs26 III; fmi-1(hd121) V. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdIs26 [odr-2p::CFP + sra-6p::DsRed2] III. Ventral cord cross-over defects. PVQ axons sometimes stop short or leave the ventral cord. Reference: Steimel A, et al. Development. 2010 Nov;137(21):3663-73.
VH17 C. elegans ast-1(rh300) II; rhIs4 III. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. Ventral cord midline crossing defects.
VH1940 C. elegans cdh-4(hd40) III. Show Description
Partially penetrant embryonic and larval lethality. Variable morphological defects. Reference: Schmitz C, et al. Dev Biol. 2008 Apr 15;316(2):249-59.
VH254 C. elegans pha-1(e2123) III; hdEx81. Show Description
hdEx81 [F25B3.3::tau352(PHP) + pha-1(+)]. Maintain at 25C to select for array. Animals become progressively uncoordinated with age. Reference: Brandt R, et al. Neurobiol Aging. 2009 Jan;30(1):22-33.
VH255 C. elegans pha-1(e2123) III; hdEx82. Show Description
hdEx82 [F25B3.3::tau352(WT) + pha-1(+)]. Maintain at 25C to select for array. Animals become progressively uncoordinated with age. Reference: Brandt R, et al. Neurobiol Aging. 2009 Jan;30(1):22-33.
VH29 C. elegans cdh-4(rh310) rhIs4 III. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. Lateral axons and ventral cord cross-over defects. Partially penetrant embryonic and larval lethality. Reference: Schmitz C, et al. Dev Biol. 2008 Apr 15;316(2):249-59.
VH4 C. elegans rhIs4 III; zag-1(rh315) IV. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. Hypomorph. Unc. Axon outgrowth defects and misexpression of glr-1::GFP marker.
VH624 C. elegans rhIs13 V; nre-1(hd20) lin-15B(hd126) X. Show Description
rhIs13 [unc-119::GFP + dpy-20(+)]. RNAi hypersensitive, effective RNAi in the nervous system. unc-119::GFP in neurons is almost completely suppressed on anti-GFP RNAi plates. Reduced progeny at 25C (almost sterile). nre-1(hd20) and lin-15B(hd126) seem very closely linked. Maintain at 15C or 20C.
VH7000 C. elegans F21D5.6(hd7000[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Deletion of 964 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAAGCAGATTTTTTTCCAAAAAATGAGCT; Right flanking sequence: CGGATTCTGGTAATTTTGCAGGTTTAGTTT. sgRNA #1: GATTGATTTGGTTCCCTTCG; sgRNA #2: TTTTCTCGAATAACTCTCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7001 C. elegans gna-1(hd7001[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Deletion of 439 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTAACGTGTGAAATTTAGAAGCGCTGAG; Right flanking sequence: AGGAATGTGTGGAGCTAACACAGACGCATC. sgRNA #1: TCATAAAATTGCAATCGTCC; sgRNA #2: AAATTGTCAGGAAGATTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7018 C. elegans col-144(hd7006[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1165 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAACATATACATAGGTTACTACGATCCCA; Right flanking sequence: AGTAAGGTCATTCTGCGTCTCTCTTCATTT. sgRNA #1: AGAACCGCAATTACGATTAT; sgRNA #2: CAAAAGAATCTGCCGATGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7019 C. elegans W10C8.4(hd7005[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1936 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGGTTTACAAAGTTTTAGCGGCCGACACCT; Right flanking sequence: AGGAATGATTCAAGATATATATATATATAG. sgRNA #1: TCTTATCTTAGAAACCCGCG; sgRNA #2: CTGTGTGTGAATACCAATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7020 C. elegans gst-28(hd7007[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 991 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTACTGAGTATCTGGACGAGCCTCTACCCA; Right flanking sequence: CGGAAGTCCTCGAATGGAACATCTGCCAAG. sgRNA #1: CAATTCCAGCTATCAGGAAG; sgRNA #2: TTCCATCTCCGTGTGTCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7022 C. elegans ctf-18(hd7009[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCATTGTGTAATCTTTTCATTGCTCCG; Right flanking sequence: AAATGTTAGAAACACAATCTCACAACAATA. sgRNA #1: AAGAAGAAGAGACTATCTGC; sgRNA #2: CTAATGGATACAGCAAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7025 C. elegans F28H1.4(hd7025[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3045 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAGTTGGGTGAAAAAGATCTTGCGAATTA; Right flanking sequence: AGGGAACTGTTCGAGAAAAAATGGGACAAG. sgRNA #1: GAGGGTGATACGTACATGTA; sgRNA #2: AAGAAAATGGGGAAACACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7026 C. elegans lbp-5(hd7016[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1790 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCTGATAATAAAACTTTCTTCAAATGCG; Right flanking sequence: GGCGGGCAACAAGGTTAAACGATGGCCAAT. sgRNA #1: AACTTTCTTCAAATGCGAGT; sgRNA #2: TTTAACGTGGAAGAGATGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7028 C. elegans F33D11.1(hd7023[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 515 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTGAATCAAGCCCCAGTTGGCAGTCATTT; Right flanking sequence: TGGGATCTTCAACTTCGGATGATTGTTTGC. sgRNA #1: CATACAATGCCACACACGCG; sgRNA #2: GTGTTCATTCCGATTGTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7030 C. elegans F43C1.7(hd7013[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 984 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGATAAAAATTAGGTATTTCAGGTTTTCCA; Right flanking sequence: GGGTTACTGTAGACGAAATGAATCCGAAAA. sgRNA #1: AACAACTTGAAGGAACTCAA; sgRNA #2: CATAAATATTAAAGCCGGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7031 C. elegans dlat-1(hd7031[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 1998 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGCATCGTGTGTGGCTTCTCGAGGAACTC; Right flanking sequence: TTTATCACACCGATTTTTTTTTATTTTCGC. sgRNA #1: CTTGAAGTGACGAAGCCAGA; sgRNA #2: CAAGGCGCGCGTGTTTAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.