Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC3967 C. elegans Y69A2AR.32(gk5043[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCGAAACAATGATAATTATCACGATCAAC; Right flanking sequence: CTGATGTCCACTCCGATGCCGCCTCCAGGA. See WormBase Variation gk5043 for details.
VC3973 C. elegans zipt-13(gk5051[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTGTCAGAGCAATGTTGAGAAATCCTCCT; Right flanking sequence: GTCCTTGTTGAGCATGTATCGCAATGCAAG. See WormBase Variation gk5051 for details.
VC3974 C. elegans C06G4.1(gk5052[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2869 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAGACAAATCGATATTTGTATCCAGCG; Right flanking sequence: TCTTCCAAGTTCGTGTTCCAGAAAACATGG. See WormBase Variation gk5052 for details.
VC3975 C. elegans +/nT1 IV; sas-5(gk5038[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
Recessive lethal deletion balanced by nT1. Deletion of 1442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCAGCTTCCACAAGAAAGGACAAAACCCC; Right flanking sequence: GGTACCTGAGACTCCAGCTGAACGAGAACG. See WormBase Variation gk5038 for details.
VC3977 C. elegans C48B6.3(gk5054[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 801 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CGAGCTGTTCTTCGAGAACTGGCGGTGCCC; Right flanking sequence: AAATAACTCAACGACATCTCCAACGTCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3979 C. elegans ZK185.5(gk5056[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 4521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCGTTTACTTTTCTTGGTTTAATCACTTT; Right flanking sequence: CGCCTGATAATCTTCTAAAACTTTGAACAG. See WormBase Variation gk5056 for details.
VC3981 C. elegans F59G1.4(gk5058[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1769 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACTACAATAGAGTTCCACTAACGCCAACT; Right flanking sequence: TTTGGTAATTTGCCAAAATTCGACGGTCAT. See WormBase Variation gk5058 for details.
VC3983 C. elegans mrps-26(gk5010[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
Recessive lethal deletion balanced by qC1. Deletion of 993 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGGACGATGTCTTTTGGCATCTGCCATGTC; Right flanking sequence: GGACATGATGTGAGTTATTTTTGAACATCG. See WormBase Variation gk5010 for details.
VC3985 C. elegans cfim-2(gk5017[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 IV; +/nT1 V. Show Description
Recessive lethal deletion balanced by nT1. Deletion of 2670 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTGTTTGAGGATTGATGGCTGAATTGGAC; Right flanking sequence: ATTAAATAACACGACTTTCTTCAAATTCAA. See WormBase Variation gk5017 for details.
VC3986 C. elegans Y18D10A.9(gk5013[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hIn1[unc-101(sy241)] I . Show Description
Recessive lethal deletion balanced by hIn1. Deletion of 4986 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAAATTTCGGATTCGGGTTCCATGCCA; Right flanking sequence: GTCTGAAAATTGAAAATAAATTTAAAAACT. See WormBase Variation gk5013 for details.
VC3988 C. elegans H04D03.3(gk5060[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2070 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTCCGATTTAAAACTGTCTCTTCCTCTA; Right flanking sequence: CTGGTCATGTTTTTCGAATATTCCACAATT. See WormBase Variation gk5060 for details.
VC3992 C. elegans lron-10(gk5064[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2073 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGAGCACTGAACCAGCTTTTCGCCGCCT; Right flanking sequence: GATGGAGGTCATGCCTAAACGAAACAAAAA. See WormBase Variation gk5064 for details.
VC3994 C. elegans F25H2.3(gk5066[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1526 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTCACAATTACGATCAGGTTTTATGTATG; Right flanking sequence: TATTTTTAGAGATCTTCAAACGAAGATCAG. See WormBase Variation gk5066 for details.
VC3996 C. elegans lron-6(gk5068[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1960 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACAGACCACTCAACATAGCCATCACTTCG; Right flanking sequence: TGATACCGTGTGCTTGAGCATGAAGTGGAT. See WormBase Variation gk5068 for details.
VC4000 C. elegans oig-5(gk5072[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2650 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTTCTCTGGTGGTAGCGATGATGGTAGAA; Right flanking sequence: GGCTGAAATCAATGCGTGGTAGCCTAAAGA. See WormBase Variation gk5072 for details.
VC4003 C. elegans F54D1.1(gk5076[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCCAAGTCAATATTTTCATTATTTCCTCAT; Right flanking sequence: ATTTGTTACTGAAATCTCAGATAACAATGC. See WormBase Variation gk5076 for details.
VC4006 C. elegans igeg-1(gk5079[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1917 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAATTGGAGAGAGCAGTGGACAGAGGT; Right flanking sequence: TGAGGGGAATACGCCAGGTTTCGCCAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4007 C. elegans igeg-2(gk5080[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1974 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGCTATTGTGTCACCGTTCCTCTGTCCA ; Right flanking sequence: ACAGGAATGAGGGAGTGTCAAGGAAAAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4008 C. elegans lron-1(gk5081[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 3289 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGATCACTCATTTCCTTATTCTTTCCAGGT; Right flanking sequence: TTTGGTTTCCTATCCCTTTTCAACAAATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4009 C. elegans H28G03.1(gk5082[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1570 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTATATTGTTCTTCACGCCAGGTCTACAA; Right flanking sequence: GGAGGTACCACAACGGAGGTAAATTTGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4014 C. elegans gkDf67[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] II. Show Description
Homozygous viable. Deletion of 9369 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGAGTAGAAAAGGGACCGACTAGGCCACCT ; Right flanking sequence: AACGATGTCCTGCATTAGCATTGGACCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4018 C. elegans ZK616.1(gk5090[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2060 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACATTTATTCCTGTTTCACTACATCATGAT ; Right flanking sequence: ACACTCCGTTTTGAACGTAGAAAAGTGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4020 C. elegans R09B3.2(gk5093[loxP + myo-3p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 621 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: ACCCGATATGAAGATCAACTTATTTGTTGG ; Right flanking sequence: TTTGGCCCCGCCCCTCGAATAGCATCGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4022 C. elegans lgc-6(gk5095[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATGGTTACAATAACTCCAAATACATTTATT ; Right flanking sequence: CTTCCCATAGACCTACATTCTGACACCGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4024 C. elegans lgc-13(gk5097[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2024 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTATGAAAAAGATGTCTCTCCCGTGTATG ; Right flanking sequence: GCATTGGGCAATCTCATGTTTCATTTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4026 C. elegans lron-4(gk5099[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2314 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CACGTTGCTCTCACAACTTGCATTCCGCAG ; Right flanking sequence: ATTGGTTTTTATAGTTATTAGTATTACTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4028 C. elegans lgc-14(gk5101[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1770 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGAGAGCTTTCTGGCATTTCCTAACCACCG ; Right flanking sequence: CTTGGTGTCTATATCATTGTGAATCTTGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4031 C. elegans Y57G11C.22(gk5104[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 5973 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACAATTGATTCAAGTTAGCTTGAATCCTGT ; Right flanking sequence: GGTGGAATGTCTCCAATACACGACATACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4032 C. elegans hrpf-2(gk5105[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2633 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCCATATGCAGAATGAGCAGCTGTGGGATA ; Right flanking sequence: GGTGCGGATTGAGTTTTCACTGCAATTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4034 C. elegans rbm-12(gk5107[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 6866 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAATTCCTGATGGGGCTGTGCATATTATT ; Right flanking sequence: TGAGCTACTACAGAAGAAAAATGATAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4036 C. elegans H23N18.4(gk5109[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGTTGCATAAAAAACTACAAAATGATGCT ; Right flanking sequence: TTTGGGAAAATAAAACATGCCCAGAACTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4038 C. elegans C10C5.3(gk5112[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAATACGGTAAGTAATGTCTTATGCCTGCG ; Right flanking sequence: CCAGGTATTGAAATCTACCAAACGCTGATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4040 C. elegans F32B4.4(gk5114[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 4487 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACCCCGTCTCATCTAAAGTTTGTGTACATA ; Right flanking sequence: CTCGGAGATCACCATCACCACCGCAACAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4042 C. elegans C34D10.2(gk5116[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 6402 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCGATTATTTTCAACGCTGGCCAACCGCCG ; Right flanking sequence: CTCGTCAACTCATCTTCTACCAAATTTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4045 C. elegans F21D5.9(gk5119[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 731 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCATCGTCTTCAATCAGATTGATGTCAACA ; Right flanking sequence: CTTGGTTCTGGAATCCAATTTTCTTGATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4047 C. elegans lgc-5(gk5121[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2700 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGATTATTTTCATATAGTTGATTCCTGAC ; Right flanking sequence: GCTGGATATAAGCATCGCAGAGACACTCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4049 C. elegans C10C5.5(gk5123[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1552 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTTTTACAAGTTGTATAAAAGACCGCTC ; Right flanking sequence: ACTTTTCCCCAATGATCAACACACCGTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4050 C. elegans C29F9.6(gk5124[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1241 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCGATTTTCCCAAATTTACTGATCCGATG ; Right flanking sequence: TATGGAAGGCACTTCCAAGGACTTCCAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4054 C. elegans cpt-5(gk5128[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2432 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTCAATAAAATGTAGCATTAAGTGTAGCCA ; Right flanking sequence: ATGTATGTTTTCCGAATTATTTTTCGCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4055 C. elegans igcm-2(gk5129[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 4249 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGAGCTGATTTAATATTTGAATGTAAGG; Right flanking sequence: TTATGGTTCGTAATATTTGTTGTTGTTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4056 C. elegans igcm-4(gk5130[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2727 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTATTGTTTCTTTGTTGAATATGGTATG ; Right flanking sequence: TCTTTACCTGCTCTCCATTTTTAGACCATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4058 C. elegans gcst-1(gk5132[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27P::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1302 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCACACTGCTCAATGCGTCGCGCTGCTTCT ; Right flanking sequence: ATTTCCCTGGAGCTGAACATATTGTGAAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4060 C. elegans ech-1.1(gk5134[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2429 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTGGTTTTAGCTATAAAATTGTCCTCCA ; Right flanking sequence: TGCGGTAGTGACAAGCAAGGGCGATTTCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4063 C. elegans cul-3(gk5137[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5552 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGATATTCTGATGTATATGGATCGGATCTA. Right flanking sequence: CTTCATGCCGTCACCAATCATCATCAAGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4064 C. elegans ceh-54(gk5138[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 3125 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTATTCTGGAAATCGGCAAAAAACCAGTT ; Right flanking sequence: GTATAGATAATGCGCTTATTCAAAGTGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4065 C. elegans ampd-1(gk5139[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5156 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAAAAGTCTGATGAAGATTCTGAGCCACCA. Right flanking sequence: TACCAATGTTCCAGATATTCGTGTCAGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4067 C. elegans cus-2(gk5141[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 4196 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGAATCTCAAAAAATCGATGAAATCCATGA ; Right flanking sequence: CGGCGTCGTATCGGTAACCTTTCCAACGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4069 C. elegans aps-1(gk5143[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 738 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CATGATGCAATACATGCTTCTCTTCAGTCG. Right flanking sequence: TTGGGATAATGAAGATAATAGTAACATAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4071 C. elegans C06A6.4(gk5145[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2765 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATGAAATTTTAGTTAACATTGGCCAGTT ; Right flanking sequence: CACGGAACCGTGTCACTCCAATATCTTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4073 C. elegans fezf-1(gk5147[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2724 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACTAAAGGCAAATCTGGATATAAACCGCC ; Right flanking sequence: ATCGTATAACCTTGCATTCCACATGTTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.