Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC4380 C. elegans rpl-10(gk5261[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mIn1[dpy-10(e128)] II. Show Description
Homozygous lethal or sterile deletion balanced by mIn1. Deletion of 772 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous mIn1 is non-GFP fertile Dpy-10. Left flanking sequence: TTCTCTTCTATATATATATATTCTCCGTTT; Right flanking sequence: TAATTTGGTATCCACTGTATTTGTTGAAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
JAC127 C. elegans csbIs6. Show Description
csbIs6 [myo-3p::GFP::rpl-10a + lin-15(+)]. GFP expression in muscle. This strain was used to generate muscle specific RNAseq data. [NOTE: csbIs6 was previously described as carrying myo-3p::GFP::rpl-1. rpl-1 is another name for rpl-10a.] Reference: Wu S, et al. 2026. G3 (In Press).
ZM10380 C. elegans daf-2(e1370) III; csbIs6. Show Description
csbIs6 [myo-3p::GFP::rpl-10a + lin-15(+)]. Maintain at 15C. Temperature sensitive dauer constitutive. GFP expression in muscle. This strain was used to generate muscle specific RNAseq data. [NOTE: csbIs6 was previously described as carrying myo-3p::GFP::rpl-1. rpl-1 is another name for rpl-10a.] Reference: Wu S, et al. 2026. G3 (In Press).
ZM9156 C. elegans daf-16(mu86) I; csbIs6. Show Description
csbIs6 [myo-3p::GFP::rpl-10a + lin-15(+)]. Dauer-defective. GFP expression in muscle. This strain was used to generate muscle specific RNAseq data. [NOTE: csbIs6 was previously described as carrying myo-3p::GFP::rpl-1. rpl-1 is another name for rpl-10a.] Reference: Wu S, et al. 2026. G3 (In Press).