SU159 |
C. elegans |
ajm-1(ok160) X; jcEx44. Show Description
jcEx44 [ajm-1::GFP + rol-6(su1006)]. Throws Rollers (weak -- some animals appear nearly wild-type) expressing ajm-1::GFP and dead eggs.
|
|
SU180 |
C. elegans |
itr-1(jc5) jcIs1 IV. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. itr-1(jc5) is cold sensitive. Progeny of homozygotes reared at 15C exhibit 95% maternal effect lethality, while progeny of homozygotes reared at 20C exhibit 15.2% lethality. Arrested embryos are defective in epithelial morphogenesis. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4.
|
|
SU265 |
C. elegans |
jcIs17. Show Description
jcIs17 [hmp-1p::hmp-1::GFP + dlg-1p::dlg-1::DsRed + rol-6(su1006)]. Rollers. References: Zaidel-Bar R, et al. J Cell Biol. 2010 Nov 15;191(4):761-9. Raich WB, et al. Curr Biol. 1999 Oct 21;9(20):1139-46.
|
|
SU295 |
C. elegans |
jcIs25. Show Description
jcIs25 [pPE103 (jac-1::GFP) + rol-6(su1006)]. Rollers. Reference: Pettitt et al. 2003. LCB 162:15-22.
|
|
SU93 |
C. elegans |
jcIs1 IV. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.
|
|
TB1682 |
C. elegans |
chEx1682. Show Description
chEx1682 [pLH070(qua-1(full-length)::GFP + rol-6(su1006)]. Rollers. Maintain under normal conditions; pick rollers. Reference: Hao et al. (2006) Dev Dyn 235:1469-81.
|
|
TG1681 |
C. elegans |
vtIs1 V; tsp-17(gt1681) X. Show Description
vtIs1 [dat-1p::GFP + rol-6] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
TG2394 |
C. elegans |
cat-2(e1112) II; vtIs1 V; tsp-17(gt1681) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
TG2401 |
C. elegans |
dat-1(ok157) III; vtIs1 V; tsp-17(gt1681) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Many animals roll weakly or not at all, but still express GFP. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
TG2411 |
C. elegans |
vtIs1 dop-2(vs105) V; tsp-17(gt1681) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
TG2415 |
C. elegans |
vtIs1 dop-2(vs105) V; dop-1(vs100) dop-3(vs106) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
TG2416 |
C. elegans |
vtIs1 dop-2(vs105) V; dop-1(vs100) dop-3(vs106) tsp-17(gt1681) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
TG2435 |
C. elegans |
vtIs1 V. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll well, but GFP expression is easily detected. Reference: Nass R, et al. Proc Natl Acad Sci U S A. 2002 Mar 5;99(5):3264-9. Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
TG2436 |
C. elegans |
vtIs1 V; tsp-17(tm4995) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. [NOTE: tsp-17(tm4995) is the correct allele carried in this strain. The genotype was annotated incorrectly in Masoudi N, et al. (S. Mitani, 11/2016)] Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
TG2437 |
C. elegans |
vtIs1 V; tsp-17(tm5169) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
TG4100 |
C. elegans |
vtIs1 V; glit-1(gt1981) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. gt1981 is a point mutation in a highly conserved residue. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/203067.
|
|
TG4103 |
C. elegans |
ttr-33(gt1983) vtIs1 V. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/198606.
|
|
TJ3014 |
C. elegans |
zIs3000 II. Show Description
zIs3000 [old-1(+) + rol-6(su1006)]. Rollers. Shows life extension and stress resistance. zIs3000 is prone to silencing.
|
|
TJ356 |
C. elegans |
zIs356 IV. Show Description
zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson². ²Correspondence: johnsont@colorado.edu. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
TL8 |
C. elegans |
bam-2(cy6) I; cyIs4 V. Show Description
cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.
|
|
TL9 |
C. elegans |
bam-2(cy7) I; cyIs4 V. Show Description
cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.
|
|
TU6276 |
C. elegans |
uIs115; kuIs70. Show Description
uIs115 [mec-17p::RFP]. kuIs70 [alr-1p::GFP + rol-6(su1006)]. Rollers. PVM neurons are marked with RFP, allowing FACS sorting by
subtraction: FACS sort red cells only to exclude exclude other neurons that are marked with either GFP or both RFP & GFP. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
TY1774 |
C. elegans |
yIs2 IV. Show Description
yIs2 [xol-1::lacZ + rol-6(su1006)] IV. Rollers. XO-specific expression of lacZ fusion.
|
|
TY1775 |
C. elegans |
yIs2 him-8(e1489) IV. Show Description
yIs2 [xol-1::laxZ + rol-6(su1006)] IV. Rollers. XO-specific expression of lacZ fusion.
|
|
TY2431 |
C. elegans |
him-8(e1489) IV; yIs34 V. Show Description
yIs34 [(pMN15.1) xol-1::GFP + rol-6(su1006)]. Pick Rollers. xol-1::GFP translational fusion with sXO-specific expression. Strain gives some non-Rollers, which represent silenced arrays.
|
|
TY2438 |
C. elegans |
yIs33 III. Show Description
yIs33 [xol-1::lacZ + rol-6(su1006)]. Rollers. XO-specific expression of lacZ fusion.
|
|
TY2439 |
C. elegans |
yIs33 III; him-8(e1489) IV. Show Description
yIs33 [xol-1::lacZ + rol-6(su1006)]. Rollers. XO-specific expression of lacZ fusion. Not all animals Roll.
|
|
TY3753 |
C. elegans |
daf-7(e1372) III; cuIs2 IV. Show Description
cuIs2 [myo-2c:: GFP + rol-6(su1006)]. Weak Rollers. Dauer constitutive at higher temperatures. Maintain at 15C.
|
|
TY3837 |
C. elegans |
dpy-28(y402)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP y402 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.
|
|
TY3856 |
C. elegans |
cuIs5 I. Show Description
cuIs5 [myo-2c:: GFP + rol-6(su1006)]. Rollers. GFP+ in pharynx.
|
|
TY3862 |
C. elegans |
daf-7(e1372) III; cuIs5. Show Description
cuIs5 [myo-2c:: GFP + rol-6(su1006)]. Daf-c. Maintain at 15C. Rollers. GFP+ in pharynx. Reference: Reiner DJ, et al. (2008) Current Biology 18(15):1101-9.
|
|
TY3886 |
C. elegans |
cuIs5 I; daf-3(e1376) X. Show Description
cuIs5 [myo-2c::GFP + rol-6(su1006)]. Rollers. GFP+ in pharynx.
|
|
TY4381 |
C. elegans |
dpy-28(s939)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP s939 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.
|
|
UA2 |
C. elegans |
baEx2. Show Description
baEx2 [lis-1::GFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
UA46 |
C. elegans |
baEx46. Show Description
baEx46 [nud-1::lacZ + rol-6(su1006)]. Maintain by picking Rollers.
|
|
UA47 |
C. elegans |
baIs13. Show Description
baIs13 [nud-1::GFP + rol-6(su1006)]. Rollers.
|
|
UL1 |
C. elegans |
leIs1 V. Show Description
leIs1 [pes-1::lacZ + rol-6(su1006)] V. Rollers. B-galactosidase expression begins in a subset of cells of the AB lineage which go on to produce muscle, nerve and hypodermal cells. B-galactosidase is also present within the D lineage until the cells move anteriorly to become body wall cells. Expression is also apparent in Z1 and Z4 which go on to form part of the somatic gonad. plasmid name: pUL#24C7. Plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.
|
|
UL2992 |
C. elegans |
leEx2992. Show Description
leEx2992 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
|
|
UL2994 |
C. elegans |
leEx2994. Show Description
leEx2994 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
|
|
UL2996 |
C. elegans |
leEx2996. Show Description
leEx2996 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
|
|
UL3294 |
C. elegans |
leEx3294. Show Description
leEx3294 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
|
|
UL3295 |
C. elegans |
leEx3295. Show Description
leEx3295 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
|
|
UL3351 |
C. elegans |
leEx3351. Show Description
leEx3351 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
|
|
UL6 |
C. elegans |
leIs6. Show Description
leIs6 [vha-8::lacZ + rol-6(su1006)]. Rollers. This strain shows B-galactosidase expression in the excretory cell and lateral nuclei of the hypodermis adjacent to the anterior and posterior branches of the excretory cell. The second component to this expression pattern appears to be localized in the hypodermis adjacent to the excretory canals. B-galactosidase was seen in the nuclei from late embryogenesis through to the adult. plasmid name: pUL#64A1. Partial Sau3A fragments cloned into BamH1 site of vector. Plasmid backbone: pPD22.11. A 2.7 Kb HindIII fragment from the insert of pUL#64A1 hybridized to YACs Y55E11, Y53F3, Y50C9, and Y73B6 which overlap on LGIV. References: Young JM, Hope IA. Dev Dyn. 1993 Feb;196(2):124-32. Hope IA, et al. Mol Gen Genet. 1998 Nov;260(2-3):300-8.
|
|
UL8 |
C. elegans |
leIs8. Show Description
leIs8 [unc-5::lacZ + rol-6(su1006)]. Rollers. B-galactosidase expression was observed in the spermathecaeand the three rectal epithelial cells. Staining in the rectal area first observed in L1 larvae whilst expression in the spermathecae appeared as the structure formed in L4 larvae. Variable staining was also seen throughout the uterus. In the mature gonad staining appeared to be in two sets of two toroidal epithelial cells Ut-1 and Ut-2. Staining was also observed in the large H shpaed Use cell which attaches the uterus to the seam cells and the four epithelial cells Ut-1 and Ut-2. The Uv cells did not appear to stain. Individual worms often just showed one component of this expression. In males the expression was observed to be displayed in all or part of the procodeum. plasmid name: pUL#38E12. plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.
|
|
UN1502 |
C. elegans |
xbIs1502. Show Description
xbIs1502 [act-1::GFP + rol-6(su1006)]. GFP-labeled actin in the spermatheca. Reference: Wirshing ACE &, Cram EJ. Mol Biol Cell. 2017 Jul 7;28(14):1937-1949. doi: 10.1091/mbc.E17-01-0029. PMID: 28331075
|
|
UTK1 |
C. elegans |
utkIs1. Show Description
utkIs1 [mbr-1p::GFP + rol-6(su1006)]. Culture under normal conditions. Reference: Curr Biol. 2005 Sep 6;15(17):1554-9.
|
|
UTK11 |
C. elegans |
soc-1(n1789) V; mbr-1(qa5901) X; utkEx6. Show Description
utkEx6 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
|
|
UTK12 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X: utkEx7. Show Description
utkEx7 [mbr-1p::GFP + cwn-1p(1.4kb)::cwn-1 + rol-6(su1006)]. Rollers.
|
|
UTK13 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx8. Show Description
utkEx8 [mbr-1p::GFP + cwn-1p(0.7kb)::cwn-1 + rol-6(su1006)]. Rollers.
|
|