More Fields
Strain Species Genotype
ZM9176 C. elegans hpIs603. Show Description
hpIs603 [lgc-55Bp::tomm20::miniSOG::SL2::BFP + nmr-1p::tomm20::miniSOG::SL2::BFP + acr-5p::tomm20-miniSOG-SL2::BFP + lin-15(+)]. MiniSOG neuron ablation of all premotor interneurons, B-class motor neurons (B-MN), and other neurons. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
ZM9583 C. elegans unc-2(hp858) X. Show Description
GFP tag inserted at the N-terminus (immediately in front of the ATG start codon) of the unc-2 locus specifically tagging the UNC-2B isoform. hp858 animals exhibit wildtype motor behaviors. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
ZR1 C. elegans rbr-2(tm1231) IV. Show Description
648 bp deletion (confirmed). About 80% of animals show defects in vulval development (Muv or Vul).
ZR2 C. elegans jmjd-3.1(gk384) X. Show Description
Gonadal enlargement and aberrant gonad migration. Phenotype evident at 25C.
ZT3 C. elegans csr-1(fj54) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.
ZW127 C. elegans zwIs106. Show Description
zwIs106 contains [unc-9p::GFP + lin-15(+)]. Superficially wild-type. Maintain under normal conditions. Described in Altun et al. Dev Dyn 238:1936-50 (2009).
ZW129 C. elegans unc-68(r1162) V; zwIs108. Show Description
zwIs108 [myo-3p::Myc::ryr-1 + myo-3p::GFP]. GFP is expressed in body muscles. Locomotion is similar to unc-68(r1162).
ZW281 C. elegans lin-15B&lin-15A(n765) X; zwEx101. Show Description
zwEx101 [inx-1p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW282 C. elegans lin-15B&lin-15A(n765) X; zwEx102. Show Description
zwEx102 [inx-2p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW283 C. elegans lin-15B&lin-15A(n765) X; zwEx103. Show Description
zwEx103 [inx-3p::GFP + lin-15(+)]. Pick non-Muv to maintain. Maintain under normal conditions. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW284 C. elegans lin-15B&lin-15A(n765) X; zwEx104. Show Description
zwEx104 [inx-4p::GFP + lin-15(+)]. Pick non-Muv to maintain. Maintain under normal conditions. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW285 C. elegans lin-15B&lin-15A(n765) X; zwEx105. Show Description
zwEx105 [inx-5p::GFP + lin-15(+)]. Pick non-Muv to maintain. Maintain under normal conditions. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW286 C. elegans lin-15B&lin-15A(n765) X; zwEx106. Show Description
zwEx106 [inx-6p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW287 C. elegans lin-15B&lin-15A(n765) X; zwEx107. Show Description
zwEx107 [inx-7p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW288 C. elegans lin-15B&lin-15A(n765) X; zwEx108. Show Description
zwEx108 [inx-8p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW289 C. elegans lin-15B&lin-15A(n765) X; zwEx109. Show Description
zwEx109 [inx-9p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW290 C. elegans lin-15B&lin-15A(n765) X; zwEx110. Show Description
zwEx110 [inx-10p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW291 C. elegans lin-15B&lin-15A(n765) X; zwEx111. Show Description
zwEx111 [inx-11p:GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW292 C. elegans lin-15B&lin-15A(n765) X; zwEx112. Show Description
zwEx112 [inx-12p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW293 C. elegans lin-15B&lin-15A(n765) X; zwEx113. Show Description
zwEx113 [inx-13p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW294 C. elegans lin-15B&lin-15A(n765) X; zwEx114. Show Description
zwEx114 [inx-14p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW295 C. elegans lin-15B&lin-15A(n765) X; zwEx115. Show Description
zwEx115 [inx-15p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW296 C. elegans lin-15B&lin-15A(n765) X; zwEx116. Show Description
zwEx116 [inx-16p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW297 C. elegans lin-15B&lin-15A(n765) X; zwEx117. Show Description
zwEx117 [inx-17p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW298 C. elegans lin-15B&lin-15A(n765) X; zwEx118. Show Description
zwEx118 [inx-18p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW299 C. elegans lin-15B&lin-15A(n765) X; zwEx119. Show Description
zwEx119 [inx-19p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW300 C. elegans lin-15B&lin-15A(n765) X; zwEx120. Show Description
zwEx120 [inx-20p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW301 C. elegans lin-15B&lin-15A(n765) X; zwEx121. Show Description
zwEx121 [inx-21p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW302 C. elegans lin-15B&lin-15A(n765) X; zwEx122. Show Description
zwEx122 [inx-22p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW303 C. elegans lin-15B&lin-15A(n765) X; zwEx123. Show Description
zwEx123 [eat-5p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW304 C. elegans lin-15B&lin-15A(n765) X; zwEx124. Show Description
zwEx124 [unc-7ap:GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW477 C. elegans bkip-1(zw10) II. Show Description
Increased angle of head bending. Maintain under normal conditions. Reference: Chen B, et al. J Neurosci. 2010 Dec 8;30(49):16651-61.
ZW495 C. elegans zwIs132. Show Description
zwIs132 [myo-3p::GCamp2 + lin-15(+)]. Transgenic animals are GFP+ in body wall muscle. Maintain under normal conditions. Reference: Liu P, et al. J Physiol. 2011 Jan 1;589(Pt 1):101-17.
ZW64 C. elegans unc-68(r1162) V; zwIs100. Show Description
zwIs100 [rab-3p::Myc::ryr-1 + myo-3p::GFP]. GFP is expressed in body muscles. Larger and moves better than unc-68(r1162). Also called ZW64A.
ZX299 C. elegans lin-15B&lin-15A(n765) X; zxEx22. Show Description
zxEx22 [myo-3p::ChR2(H134R)::YFP + lin-15(+)].
ZX388 C. elegans lin-15B&lin-15A(n765) X; zxIs3. Show Description
zxIs3 [unc-47p::ChR2(H134R)::YFP + lin-15(+)]. Strain occasionally segregrates Muv animals; pick non-Muv animals to maintain.
ZX398 C. elegans lin-15B&lin-15A(n765) X; zxEx32. Show Description
zxEx32 [myo-3p::NpHR + myo-3p::ChR2(H134R)::YFP + lin-15(+)].
ZX422 C. elegans lin-15B&lin-15A(n765) X; zxEx33. Show Description
zxEx33 [unc-17p::NpHR::eCFP + lin-15(+)].
ZX460 C. elegans zxIs6 V. Show Description
zxIs6 [unc-17p::ChR2(H134R)::YFP + lin-15(+)] V.
ZX679 C. elegans zxIs12. Show Description
zxIs12 [F49H12.4P::ChR2(H134R)::mCherry + F49H12.4P::GFP]. Strain expresses Channelrhodopsin-2 (ChR2(H134R)::mCherry) and GFP (as marker) in PVD and AQR, as well as in a non-identified tail neuron, using the F49H12.4 promoter. When grown in the presence of all-trans retinal and illuminated with blue light, animals show strong forward locomotion escape behavior, which can be quantified using locomotion video tracking. The strain can be used to analyze function of PVD cells, and to estimate the role of specific genes in the function of this polymodal nociceptor, downstream of depolarization via ChR2. All-trans retinal needs to be added with OP50 bacteria when seeding plates to render ChR2 functional. References: Husson S, et al. Curr Biol. 2012 May 8;22(9):743-52. Smith CJ, et al. Neuron. 2013 Jul 24;79(2):266-80. Cohen E, et al. Molecular and Cellular Neuroscience 2104 59C: 85-96.
ZX819 C. elegans lite-1(ce314); zxIs12. Show Description
zxIs12 [F49H12.4P::ChR2(H134R)::mCherry + F49H12.4P::GFP]. Strain expresses Channelrhodopsin-2 (ChR2(H134R)::mCherry) and GFP (as marker) in PVD and AQR, as well as in a non-identified tail neuron, using the F49H12.4 promoter (see also ZX679). When grown in the presence of all-trans retinal and illuminated with blue light, animals show strong forward locomotion escape behavior, which can be quantified using locomotion video tracking. The strain can be used to analyze function of PVD cells, and to estimate the role of specific genes in the function of this polymodal nociceptor, downstream of depolarization via ChR2. All-trans retinal needs to be added with OP50 bacteria when seeding plates to render ChR2 functional. This strain is in lite-1(ce314) background, which eliminates the photophobic behavioral response that will be startled by blue light when longer light stimuli are used (>1s). To not confuse the photophobic behavior induced by LITE-1, with the PVD evoked escape behavior, this strain is needed for experiments with prolonged photostimulation. References: Husson S, et al. Curr Biol. 2012 May 8;22(9):743-52. Smith CJ, et al. Neuron. 2013 Jul 24;79(2):266-80. Cohen E, et al. Molecular and Cellular Neuroscience 2104 59C: 85-96.
ZX899 C. elegans lite-1(ce314) X; ljIs123; zxEx621. Show Description
ljIs123 [mec-4p::ChR2(H134R)::YFP(codon-optimized) + unc-122p::RFP]. zxEx621 [glr-1p::Mac::mCherry + elt-2p::GFP]. Pick animals with robust GFP expression in intestinal nuclei to maintain.
ZZ1 C. elegans lev-11(x1) I. Show Description
Levamisole resistant. Twitcher.
ZZ1004 C. elegans unc-63(x18) dpy-5(e61) I. Show Description
ZZ1012 C. elegans unc-74(x19) dpy-5(e61) I. Show Description
ZZ1015 C. elegans unc-38(x20) dpy-5(e61) I. Show Description
ZZ12 C. elegans lev-11(x12) I. Show Description
Levamisole resistant twitcher. Weakly semi-dominant. M-MATING++ 1-10%WT.
ZZ13 C. elegans unc-63(x13) I. Show Description
Levamisole resistant Unc. Tends to accumulate eggs. M-MATING+++ 10-30%WT. pka lev-7.
ZZ15 C. elegans lev-8(x15) X. Show Description
Pseudowild levamisole resistance. Head more resistant than body. Body resistance is temperature sensitive. WT phenotype.
ZZ16 C. elegans lev-9(x16) X. Show Description
Pseudo wild type levamisole resistance. WT phenotype.