More Fields
Strain Species Genotype
CZ23908 C. elegans rab-8(tm2526) I; muIs32 II. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. Homozygous viable. Reference: Kim KW, et al. Elife. 2018 Nov 21;7:e39756. doi: 10.7554/eLife.39756. PMID: 30461420
VC4288 C. elegans srab-8(gk5371[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1276 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAATTATTGTGTTCCCTGATAGCATTGCC; Right flanking sequence: TATGCCGTTGTTTCTATTCTTATTTTGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.