More Fields
Strain Species Genotype
VC768 C. elegans kle-2(ok1151) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C29E4.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1151 homozygotes (sterile Unc often with withered tail). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC772 C. elegans ZK1128.4&swsn-2.1(ok1200) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK1128.4, ZK1128.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1200 homozygotes (Dpyish, mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC805 C. elegans gly-3(gk353) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK688.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk353 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC828 C. elegans unc-94(ok1210) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C06A5.7a. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1210 homozygotes (grotty sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC829 C. elegans unc-108(ok1246) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F53F10.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1246 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC832 C. elegans F49D11.10(ok1189) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F49D11.10. Homozygous lethal deletion chromosome balanced by bli-4- let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1189 homozygotes (probable early larval arrest). Homozygous hT2[qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC848 C. elegans mev-1(ok909) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T07C4.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok909 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC872 C. elegans rbm-42(gk368) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y54H5A.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk368 homozygotes (scrawny Unc, late larval arrest or sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC873 C. elegans rbm-42(gk369) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y54H5A.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk369 homozygotes (scrawny Unc, late larval arrest or sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC877 C. elegans lnkn-1(gk367) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk367 homozygotes (sterile, mildly Unc). The Unc phenotype is not a consequence of the deletion, as it is separable by recombination. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC891 C. elegans aha-1(ok1396) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C25A1.11. Homozygous lethal deletion chromosome balanced by bli-4- let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1396 homozygotes (early larval arrest). Homozygous hT2[qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC899 C. elegans cle-1(gk390) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C36B1.1. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk390 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC924 C. elegans dcp-66(gk370) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C26C6.5a. Homozygous sterile deletion chromosome balanced by bli-4-, let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk370 homozygotes (scrawny, Unc sterile, often with protruding vulva; distintegrates in early adulthood). Homozygous hT2[qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC927 C. elegans pnk-1(ok1435) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C10G11.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1435 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC939 C. elegans tag-342(gk422) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0464.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk422 homozygotes (sterile, mildly Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC948 C. elegans cel-1(gk419) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C03D6.3. Homozygous lethal deletion chromosome balanced by bli-4- let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk419 homozygotes (Dpyish, late-larval or early adult arrest). Homozygous hT2[qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC952 C. elegans Y111B2A.10a(gk415) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y111B2A.10a. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk415 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC954 C. elegans rnf-113(ok1401) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K01G5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1401 homozygotes (Dpy, mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC961 C. elegans egg-1(ok1459) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0244.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1459 homozygotes (small, sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
WH216 C. elegans sep-1(e2406) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes have myo-2::GFP [qIs48] strongly expressed in the pharynx and are viable at 25C. 100% of sep-1 homozygotes are strongly Sterile Unc at 25C (at 20C, 100% are Sterile but no so Unc). Up to 30% of the homozygotes are Sterile at 16C. hT2[qIs48] homozygotes are dead. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
WH377 C. elegans car-1(tm1753) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. car-1 homozygotes are have no GFP and produce embryos with cytokinesis defect (embryonic lethal). Some recombination.
WH468 C. elegans sep-1(e2406) I/hT2 (I;III); ruIs32 III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Homozygous embryonic lethal mutation balanced by bli-4- and GFP-marked translocation. Maintain at 15 C. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP e2406 homozygotes (embryonic arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Bembenek J, et al. Curr Biol (2010) Feb 9;20(3):259-64.
WH485 C. elegans sep-1(e2406) I/hT2 (I;III); ojIs58 III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ojIs58 [pie-1p::sep-1::GFP + unc-119(+)] III. Homozygous embryonic lethal mutation balanced by bli-4- and GFP-marked translocation. Maintain at 15 C. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP e2406 homozygotes (embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Bembenek J, et al. Curr Biol (2010) Feb 9;20(3):259-64.
WS2265 C. elegans hus-1(op244) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT GFP+ and segregate non-glowing hus-1 homozygotes and very rare homozygous hT2 glowing animals, and dead eggs. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and gut promoter driving GFP in the intestine. hus-1(op244) mutants from homozygous parents show an incompletely penetrant maternal effect embryonic lethality. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
ZT2 C. elegans drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.
AD266 C. elegans egg-4(tm1508) egg-5(ok1781) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1508 ok1781 homozygotes (maternal sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Parry JM, et al 2009 Current Biology 19(20):1752-7.
BN360 C. elegans ima-2(ok256) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III); qaIs3502; ojIs1. Show Description
ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Germline expression of YFP::lmn-1. CFP::HIS is silenced in qaIs3502. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strains XA3502 and XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.
BS5435 C. elegans prp-17(oz273) I/hT2 (I;III); glp-1(oz264) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
glp-1(oz264) is a gain-of-function allele. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273; oz264 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
DC1079 C. elegans ces-1(n703) qDf8/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+ in the pharynx. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Presence of ces-1 is inferred from strain construction but not experimentally verified. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
DG2190 C. elegans fog-3(q443) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); tnIs13 V. Show Description
tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous fog-3(q443) animals are females.
JK2879 C. elegans gld-2(q497) gld-1(q485)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT GFP+ heterozygotes, non-GFP sterile gld-2 gld-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK4299 C. elegans gld-2(q497) gld-1(q361) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ heterozygotes to maintain. Segregates fertile GFP+ heterozygotes, non-GFP homozygous mutants (Gld; form germline tumors), very rare GFP+ homozygous hT2, and dead eggs. gld-1(q361) is a missense allele but phenotypically null, which allows the detection of gld-1 mRNA and protein by single molecule FISH or antibody staining. Reference: Hansen et al (2004) Dev. Biol. 2004;268(2):342-57. Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK4774 C. elegans lst-1(ok814) sygl-1(tm5040) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kershner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
NM2040 C. elegans dhc-1(js121) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); jsIs37 V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Heterozygotes are GFP+ in the pharynx. dhc-1 homozygotes are GFP- and sterile or partially sterile pvuls. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP js121 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
PS3976 C. elegans lin-17(en671) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); lin-18(e620) X. Show Description
Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile en671 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
RAF3 C. elegans gld-1(q485) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); fem-1(hc17). Show Description
Segregates WT GFP+ heterozygotes, non-glowing sterile gld-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. gld-1 homozygotes form germiline tumors. Maintain by mating GFP+ at 20 degrees. Reference: Biedermann et al., Dev Cell 17, 355-364 (2009).
TG1890 C. elegans mus-81(tm1937) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); xpf-1(tm2842) II. Show Description
Segregates WT GFP+ heterozygotes, non-GFP mus-81; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of mus-81; xpf-1 double homozygotes are viable. unc-119(ed3) has likely been lost through outcrossing, but could still be present in the background. Reference: Agostinho A, et al. PLos Genetics 2013.
TG1891 C. elegans slx-1(tm2644) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); xpf-1(tm2842) II. Show Description
Segregates WT GFP+ heterozygotes, non-GFP slx-1; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of slx-1 xpf-1 double homozygotes are viable. Reference: Agostinho A, et al. PLos Genetics 2013.
TH322 C. elegans unc-13(e51) rsa-1(dd10) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Maternal effect lethal (Mel) allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schlaitz et al., (2007) Cell 128:115-27.
TH323 C. elegans unc-13(e51) rsa-1(dd13) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Maternal effect lethal (Mel) allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schlaitz et al., (2007) Cell 128:115-27.
TY4986 C. elegans htp-3(y428) ccIs4251 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I,III). Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, htp-3(y428) ccIs4251 homozygotes that are GFP+ in body wall muscle but not pharynx, hT2 GFP+ homozygotes, and aneuploid dead embryos. Avoid picking viable aneuploids that often appear larger and longer than wild-type.
VC1160 C. elegans egl-30&emr-1(ok252) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
M01D7.7, M01D7.6. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok252 homozygotes (phenotype uncharacterized). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1248 C. elegans gmn-1&Y75B8A.18(ok1708) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y75B8A.17, Y75B8A.18. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1708 homozygotes (mostly sterile; occasional progeny arrest as larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TACTTCGTTTCGAGCGTCCT. External right primer: AGTAGGCCGTCAAATTGGTG. Internal left primer: TCCGCCGTCTCTTCTATTGT. Internal right primer: AACAATCCTGTTCCGCTCAT. Internal WT amplicon: 2898 bp. Deletion size: 1490 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1325 C. elegans tbg-1&F58A4.9(ok1786) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F58A4.9, F58A4.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1786 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTCGTTGTTGCGGAATTTT. External right primer: CGCCGAGTTCAAAAAGAAAG. Internal left primer: CTTTCTTCGGAAATGCTTCG. Internal right primer: GCTCAATGTGTTCGCAGAAG. Internal WT amplicon: 2187 bp. Deletion size: 1269 bp. Deletion left flank: GGCTTGAGCAAGCTGATTTCCGCACTGTCC. Deletion right flank: GAGTAAGAAAAAGAAGATCAAAGTGGATAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1752 C. elegans Y23H5A.2&cars-1(ok2280) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y23H5A.2, Y23H5A.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2280 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCCATGGAAAAGATCCGAA. External right primer: TGGAACGGAGGTAAAACGAC. Internal left primer: ACCCCATATCGTGTCAATGG. Internal right primer: ACGGATTCAAGATCTGGTGG. Internal WT amplicon: 2132 bp. Deletion size: 475 bp. Deletion left flank: CAACGCGACCGCCGAAGCCGCACAATTCTG. Deletion right flank: TTCTCCGGATCTCGAAGAAAAACGCCGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1825 C. elegans F44E2.8&F44E2.9(ok2134) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F44E2.8, F44E2.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2134 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGCTGGTTGGTTTCACCAT. External right primer: ATATGTGGAACTTGCCGGAG. Internal left primer: CATTGGAGAGAGCTTAGGCG. Internal right primer: TCGTTTTTAAATTTCCGCCA. Internal WT amplicon: 2111 bp. Deletion size: 1195 bp. Deletion left flank: TTTTTGTCGAACTTCATTCTTTACTTTACT. Deletion right flank: GGAAATAAAATCGATAAAAACTTTAAAATT. Insertion Sequence: CACGACTTCCTGTTTCTTCAGAAAAACTCTGAATGGCCGTTTCCCATTTTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1828 C. elegans tag-164&abcf-2(ok2388) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y76A2A.1, T27E9.7. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2388 homozygotes (small, sickly, tends to die out but populations are possible to maintain). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAGCAGTTGATAGCCTCG. External right primer: CGTCGCTTTTTCCGTGTATT. Internal left primer: ATAGCTGTTTCATCGGGCAC. Internal right primer: AATTTAGGGTACCCCATCCG. Internal WT amplicon: 3031 bp. Deletion size: 1245 bp. Deletion left flank: CAGGCTAAATTAGCATATTTACACAGACGA. Deletion right flank: CCGCTTGAAGAGCAGTTTTCTCTGAAGCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1835 C. elegans T28D6.6&pen-2(ok2449) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T28D6.9, T28D6.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2449 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGTCGTTTCTCGCTTTTT. External right primer: CTACGTGGAAACCGTGGAGT. Internal left primer: CCCGTGTGCCTGTAAGTTTT. Internal right primer: CTTAAAGGCGCATATCCCAA. Internal WT amplicon: 2150 bp. Deletion size: 1227 bp. Deletion left flank: TCCAGATATTGCCATAAATTTAGAGAAAAT. Deletion right flank: TTCGATTTTTTTCTGAAAAATTCAAAAATT. Insertion Sequence: ATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1847 C. elegans T28D6.6&pen-2(ok2395) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T28D6.9, T28D6.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2395 homozygotes (grotty sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGTCGTTTCTCGCTTTTT. External right primer: CTACGTGGAAACCGTGGAGT. Internal left primer: CCCGTGTGCCTGTAAGTTTT. Internal right primer: CTTAAAGGCGCATATCCCAA. Internal WT amplicon: 2150 bp. Deletion size: 832 bp. Deletion left flank: CGGCCTCGATATCCGCGATTTTTTGCAAAA. Deletion right flank: GATTTTTTTCTGAAAAATTCAAAAATTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1898 C. elegans Y66D12A.24&tin-10(ok2400) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y66D12A.22, Y66D12A.24. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2400 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGCTCACTTGACACTTTCG. External right primer: TGGGGAAAATCGAAAACTTG. Internal left primer: CTGTGCAATTTGTGATTGCC. Internal right primer: ATATGTACCGCCGAATGACC. Internal WT amplicon: 2686 bp. Deletion size: 1690 bp. Deletion left flank: TTCATTTTGGCTAATTTCTCAGTAAAAATT. Deletion right flank: TTCGATTTAAAAAAAATCGATTTTTTTCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807