More Fields
Strain Species Genotype
YG1007 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); syIs50. Show Description
syIs50 [cdh-3::GFP + dpy-20(+)]. Heterozygotes are WT and GFP+, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile and Unc). All worms express cdh-3::GFP at the anchor cell. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
YG1011 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qIs19 V. Show Description
qIs19 [lag-2p::GFP::unc-54 3'UTR + rol-6(su1006)] V. Heterozygotes are Rollers with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, and non-GFP gk324 homozygotes (Sterile and Unc). All worms express lag-2p::GFP at the distal tip cells. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
YG1017 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); syIs78. Show Description
syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Heterozygotes are WT and GFP+, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile, Roller and Unc). All worms express ajm-1::GFP (Junction Associated Protein). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
YG1021 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); ccIs4810 X. Show Description
ccIs4810 [(pJKL380.4) lmn-1p::lmn-1::GFP::lmn-1 3'utr + (pMH86) dpy-20(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile and Unc). All worms express Cel-lamin::GFP (lmn-1 gene is expressed at the nuclear periphery). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
YG1036 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); zzIs16. Show Description
zzIs16 [(pJE3) eff-1::GFP + rol-6(su1006)]. Heterozygotes are Rollers with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, and non-GFP gk324 homozygotes (Sterile, Roller and Unc). All worms express GFP driven by eff-1 promoter. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
YG1046 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); eff-1(ok1021) II; syIs78. Show Description
syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Heterozygotes are slow-growing DpyUnc with cell fusion problems and pharyngeal GFP signal. Segregates arrested hT2 aneuploids, and non-GFP DpyUnc gk324 homozygotes (Sterile, Dpy and Unc). All worms express ajm-1::GFP(Junction Associated Protein). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
YHS2 C. elegans cdc-25.1(bn115) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kim J, et al. (2009) Mol Cell 28:43-8.
ZT2 C. elegans drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.