Caenorhabditis Genetics Center (CGC)

More Fields
Strain Species Genotype
DCR3791 C. elegans pfk-1.1(ola72) X. Show Description
Diffuse distribution of synaptic vesicle markers (SNB-1, CAT-1, and RAB-3) under hypoxic conditions. pfk-1.1(ola72) causes C562Y missense mutation. Reference: Jang et al. Neuron. 2016 Apr 20;90(2):278-91.
NK2780 C. elegans qySi564 I. Show Description
qySi564 [lin-29p::pfk-1.1::mNG +loxP] I. Single-copy insertion. Anchor cell-specific expression of the mNG-tagged glycolytic enzyme PFK-1.1 forms localized puncta at the site of invasion. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
RG3461 C. elegans pfk-1.1(ve961[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 4271 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAAATACTATTGTCATAAATTACAGAATTT ; Right flanking sequence: CGACCGTTGAAAGTTCTGCAATTTTGGAAT. pfk-1.1 crRNA A: TGCATAATTCGAAATGGACG; pfk-1.1 crRNA B: AACGATGACGAGCGAGAACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.