More Fields
Strain Species Genotype
VC4467 C. elegans pbs-2(gk5540[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 960 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CATGGACTCGACGACGTCGTACTTGTAGGT; Right flanking sequence: TGATTTTCTGCAGATAACCTATTCAATAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.