More Fields
Strain Species Genotype
OH15908 C. elegans him-5(e1490) V; dmd-4(ot957ot935) X. Show Description
CRISPR-engineered deletion in dmd-4(ot935[dmd-4::GFP]) removing +3201 to +3710 relative to start codon. Partial removal of intron 3 results in loss of somatic nervous system expression without affecting pharyngeal expression.
PD1074 C. elegans C. elegans wild isolate. Show Description
A defined and recently cloned population of animals derived from the original “Bristol” variant of C. elegans originally obtained by Brenner from E. Dougherty with no known history of mutagenesis. Brenner’s original population, called N2, was used as the basis for the vast majority of laboratory strains in use currently. No early frozen stock of the unmutagenized N2 population currently exists, but later stocks were available from several laboratories. PD1074 is a clonal population founded by picking a single worm of one such stock, VC3510. VC3510 in turn derives from a subpopulation of N2 described in the literature as VC2010. PD1074 is intended to be used as a wild type reference strain with the closely matched genome assembly of Yoshimura, et al. (Genome Res. 2019 Jun;29(6):1009-1022) available on Wormbase as VC2010-1.0. (ENA study accession PRJEB28388; assembly accession GCA_900538205). We note that PD1074 is expected to be largely similar to most lab N2 strains, but that as a clonal isolate derived from N2, there will be some loci that will vary compared to any other particular N2 isolate. One such example is a partial deletion of the alh-2 locus in PD1074. Additional loci that were found to vary between the prior N2 reference genome (WormBase release WS264) and the VC2010-1.0 assembly are detailed in supplemental table 8 in Yoshimura, et al, (2019).
PR692 C. elegans che-1(p692) I. Show Description
Defective in chemotaxis to all attractants except pyridine and D-tryptophan. Partial defects in taxis to pyridine, H+(phosphate) and H+(citrate).
RB2284 C. elegans tgt-1(ok3107) IV. Show Description
ZK829.6. Homozygous. [NOTE: it has been reported that ok3107 disrupts the native locus, this strain appears to also carry at least a partial duplication of the tgt-1 locus.] Outer Left Sequence: GACATCCTACCGTTTCCTGG. Outer Right Sequence: CTCCTTTGCAACACGTACCA. Inner Left Sequence: TACGGTAGGCCCGATAATGA. Inner Right Sequence: CTTGGACATCGTCCCGGT. Inner Primer PCR Length: 1172 bp. Deletion Size: 684 bp. Deletion left flank: AAAAAAATTGTGTTCGAACGTTATTTTTAT. Deletion right flank: GTTGTCAATACATGAATTACATGATCCAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
SF1 C. elegans odc-1(pc13::Tc1) V. Show Description
Made by PCR screen of Tc1 transposon insertion library. odc-1(pc13::Tc1) has a partial deletion of the Tc1 element. Phenotypically it has 35% reduction in brood size compared to the WT N2 Bristol strain.
TU228 C. elegans mec-18(u228) X. Show Description
Mechanosensory abnormal (partial).
UL1 C. elegans leIs1 V. Show Description
leIs1 [pes-1::lacZ + rol-6(su1006)] V. Rollers. B-galactosidase expression begins in a subset of cells of the AB lineage which go on to produce muscle, nerve and hypodermal cells. B-galactosidase is also present within the D lineage until the cells move anteriorly to become body wall cells. Expression is also apparent in Z1 and Z4 which go on to form part of the somatic gonad. plasmid name: pUL#24C7. Plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.
UL6 C. elegans leIs6. Show Description
leIs6 [vha-8::lacZ + rol-6(su1006)]. Rollers. This strain shows B-galactosidase expression in the excretory cell and lateral nuclei of the hypodermis adjacent to the anterior and posterior branches of the excretory cell. The second component to this expression pattern appears to be localized in the hypodermis adjacent to the excretory canals. B-galactosidase was seen in the nuclei from late embryogenesis through to the adult. plasmid name: pUL#64A1. Partial Sau3A fragments cloned into BamH1 site of vector. Plasmid backbone: pPD22.11. A 2.7 Kb HindIII fragment from the insert of pUL#64A1 hybridized to YACs Y55E11, Y53F3, Y50C9, and Y73B6 which overlap on LGIV. References: Young JM, Hope IA. Dev Dyn. 1993 Feb;196(2):124-32. Hope IA, et al. Mol Gen Genet. 1998 Nov;260(2-3):300-8.
UL8 C. elegans leIs8. Show Description
leIs8 [unc-5::lacZ + rol-6(su1006)]. Rollers. B-galactosidase expression was observed in the spermathecaeand the three rectal epithelial cells. Staining in the rectal area first observed in L1 larvae whilst expression in the spermathecae appeared as the structure formed in L4 larvae. Variable staining was also seen throughout the uterus. In the mature gonad staining appeared to be in two sets of two toroidal epithelial cells Ut-1 and Ut-2. Staining was also observed in the large H shpaed Use cell which attaches the uterus to the seam cells and the four epithelial cells Ut-1 and Ut-2. The Uv cells did not appear to stain. Individual worms often just showed one component of this expression. In males the expression was observed to be displayed in all or part of the procodeum. plasmid name: pUL#38E12. plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.
VL1176 C. elegans alh-8(ww48) II. Show Description
Partial lethality on low B12 diet; supplemental vitamin B12 is helpful. Reference: Watson E, et al. Elife. 2016 Jul 6;5.
VT3869 C. elegans wIs51 V; hbl-1(ma430ma475[hbl-1::mScarlet-I::partial deletion of hbl-1 3'UTR]) X Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Retarded Heterochronic defects: extra seam cells and partial or no alae in young adults. hbl-1(ma430ma475) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1 and part of the 3' UTR removed. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
WHR7 C. elegans unc-119(ed3) ruIs38 III. Show Description
ruIs38 [myo-2p(partial)::GFP + unc-119(+)] III. Derived by out-crossing AZ218 eleven times to N2.
ABR156 C. briggsae Cbr-she-1(v35) IV; mfIs42. Show Description
mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863.
BA793 C. elegans spe-26(hc138) dpy-13(e184) IV. Show Description
Temperature sensitive. Fertile at 16C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage.
BA821 C. elegans spe-26(hc138) IV. Show Description
Temperature-sensitive. Maintain at 15C. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage. Increase lifespan in males and hermaphrodites.
BA824 C. elegans spe-26(hc139) dpy-20(e1282) IV. Show Description
Temperature sensitive. Partially fertile at 16C (very few progeny). Sterile at 20C and 25C. Weak Dpy at 15C. Spermatogenesis arrests at the spermatocyte stage.
BA825 C. elegans spe-26(hc140) dpy-20(e1282)/+ IV. Show Description
Heterozygotes are WT and segregate wild-type, wild-type heterozygotes, and Sterile Dpy (spe-4 dpy-20 homozygotes). Homozygous mutants are weak Dpy and partially fertile at 15C. Sterile at 20-25C. Spermatogenesis arrests at the spermatocyte stage.
BA836 C. elegans spe-26(it112) unc-22(e66) IV. Show Description
Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.
BA837 C. elegans spe-26(it112) IV. Show Description
Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage.
BA839 C. elegans spe-26(it118) unc-22(e66) IV. Show Description
Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.
BA843 C. elegans spe-26(it118) IV. Show Description
Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage.
BA925 C. elegans spe-26(hc138) dpy-20(e1282) IV. Show Description
Temperature-sensitive. Fertile and weak Dpy at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.
BOX213 C. elegans erm-1(mib15[erm-1::eGFP]) I. Show Description
Endogenous erm-1 locus tagged with eGFP. Homozygous viable, partially functional endogenous erm-1 tag. erm-1::GFP animals have a reduced brood size and incomplete outgrowth of the excretory canal, but show no other developmental or morphological abnormalities.
BP221 C. elegans eff-1(hy21) II; hyEx23. Show Description
hyEx23 [des-2p::eff-1 + des-2::GFP + rol-6(su1006)]. Cell-specific expression of eff-1 in the PVDs. Partially rescues arborization Eff-1 phenotypes. Pick GFP+ Rollers to maintain. Reference: Oren-Suissa M, et al. Science. 2010 Jun 4;328(5983):1285-8.
BP600 C. elegans aff-1(tm2214) II. Show Description
A 1.2 kb deletion in aff-1 (C44B7.3) which introduce stop codon after alanine 47. AFF-1 is a type I membrane protein necessary and sufficient for specific cell fusion events during embryonic and larval development. Temperature sensitivity was not detected. At 20° the fusion of hyp5 in the embryo does not occur as well as anchor cell (AC) fusion, vulval cells fusion of the A and D rings and the terminal fusion between the seam cells late in L4. 6% L1 rod-like lethal and 0% embryonic lethal. Adults are completely Egl, and partially Unc, Pvl. In addition, only 2% of AC in the mutant worms undergo fusion. These animals give very low brood size (16 progeny per worm) and 3.4% of the worms are sterile. This strain gives very small brood size and hence grows slowly. Originally from Shohei Mitani, Tokyo Women's Medical College, Tokyo, Japan.
CB2203 C. elegans unc-54(e190) I; dpy-11(e224) eDp22 V. Show Description
Dpy. Movement Slow. Unc partially suppressed.
CB2204 C. elegans unc-54(e190) I; eDp22 V. Show Description
Movement slow. Unc partially suppressed.
CB2213 C. elegans unc-15(e73) I; eDp22 V. Show Description
Movement slow. Unc partially suppressed.
CB2221 C. elegans unc-54(e1315) I; dpy-11(e224) eDp23 V. Show Description
Dpy. Movement Slow. Unc partially suppressed.
CB5664 C. elegans dpy-31(e2770) III; sqt-3(e2809) V. Show Description
Dumpy (partially-suppressed Dpy-31). Sqt-3 mediated suppression of dpy-31 lethality. Reference: Novelli et al. (2004) PMID: 15579684.
CF1380 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx158. Show Description
muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
CF2060 C. elegans daf-16(mu86) I; muEx158. Show Description
muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which rescues daf-16 mutants from defective dauer formation and also partially rescues longevity defect of daf-16; glp-1 double mutants. Reference: Berman JR, & Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.
CH120 C. elegans cle-1(cg120) I. Show Description
Homozygous viable and fertile. Partially penetrant Egl and cell/axon guidance defects. Deletion of nucleotides 22756-24758 based on cosmid F39H11 sequence (Genbank AF164959). Results in loss of carboxyl NC1 domain from CLE-1.
CY251 C. elegans sqt-1(sc13) age-1(mg44) II; bvIs2. Show Description
bvIs2 contains [ric-19p::age-1(cDNA)::myc::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs2 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GCA CAG TTT TAC GAA AGG AAC-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
CY262 C. elegans sqt-1(sc13) age-1(mg44) II; bvIs1. Show Description
bvIs1 contains [ges-1p::age-1(cDNA)::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs1 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GTC ATT TTG GCA CCA TAG GAG-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
CZ18637 C. elegans juSi83 II; rps-18(ok3353) IV/nT1[qIs51] (IV;V). Show Description
juSi83 [GFP::rps-18 + Cbr-unc-119(+)] II. Homozygous lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT GFP+ and segregate WT GFP+, Vul and dead eggs. Non-conditonal GFP-tagged ribosomes; array over-expressing N-terminally tagged rps-18 (small ribosomal subunit) partially rescues rps-18(ok3353) larval arrest (some animals will escape L1 arrest and develop to L3 stage). Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
DCR1337 C. elegans nsIs105 I; cima-1(wy84) IV; wyIs45 X; olaEx805. Show Description
nsIs105 [hlh-17p::GFP] I. wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx805 [hlh-17p::caspase12 + hlh-17p::caspase17 + ttx-3p::mCherry + glr-3p::mCherry + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. Ablation of CEPsh glia partially suppresses AIY presynaptic maintenance defects in cima-1(wy84) mutants. nsIs105 (hlh-17::GFP) expression labels CEPsh glia. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DG3449 C. elegans sacy-1(tn1385) I; fog-2(oz40) V. Show Description
sacy-1(tn1385) partially suppresses fog-2(oz40) self-sterility. Reference: Kim S, et al. 2012 Genetics
EG199 C. elegans nas-37(ox199) X. Show Description
At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA.
EG3283 C. elegans nas-37(tm410) X. Show Description
At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Deletion. Flanking sequences: ttcttgtccagtagggtctagtcgtggttg tgaacttgcctgtcgatgtcttctggctga.
GR1352 C. elegans daf-16(mgDf47) I; xrIs87. Show Description
xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. GFP expressed in many tissues. Partially rescued for daf-16 (daf-d).
HW1835 C. elegans lin-29(xe40 xe65[lin-29b::gfp::3xflag]) II. Show Description
Partially penetrant Pvl and Egl. xe40 specifically disrupts the LIN-29A isoform. The GFP tag was inserted at the shared C-terminus of LIN-29A/B in the xe40 background, so only the labeled B isoform is expressed. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Pereira et al., (2019) Timing mechanism of sexually dimorphic nervous system differentiation. eLIFE 8: e42078. https://doi.org/10.7554/eLife.42078
IC459 C. elegans sax-3(ky123) X; quEx102. Show Description
quEx102[F25B3.3::SAX-3 + odr-1::RFP]. F25B3.3::SAX-3 partially rescues the lethality and notch phenotype of sax-3(ky123). Maintain by picking RFP+.
IC464 C. elegans sax-3(ky123) X; quEx100. Show Description
quEx100 [ajm-1::sax-3 + odr-1::RFP]. ajm-1::sax-3 partially rescues the lethality of sax-3(ky123). Maintain by picking RFP+.
IK105 C. elegans pkc-1(nj1) V. Show Description
Thermophilic. Defective chemotaxis to AWA- and AWC- sensed odorants except for partially defective chemotaxis to pyrazine. Defective chemotaxis to NaCl. Defective osmotic avoidance. PKA ttx-4.
IK130 C. elegans pkc-1(nj3) V. Show Description
Thermophilic. Defective chemotaxis to AWA- and AWC- sensed odorants except for partially defective chemotaxis to pyrazine. Partially defective chemotaxis to NaCl. Partially defective osmotic avoidance. PKA ttx-4.
IK174 C. elegans pkc-1(nj4) V. Show Description
Thermophilic. Defective chemotaxis to AWA- and AWC- sensed odorants except for partially defective chemotaxis to pyrazine. Partially defective chemotaxis to NaCl. Partially defective osmotic avoidance. PKA ttx-4.
JC328 C. elegans flr-5(ut73) V. Show Description
Partially resistant to 400ug/ml NaF. Suppressor of the slow-growing phenotype of mutations in flr-1, flr-3, and flr-4.
JC49 C. elegans flr-2(ut5) V. Show Description
Partially resistant to 400ug/ml NaF. Weakly Dpy. (Not determined if this is due to ut5 or a closely linked mutation.) Suppressor of the slow-growing phenotype of mutations in flr-1, flr-3, and flr-4.
JK2157 C. elegans lag-2(q411) V; qEx319. Show Description
qEx319 [lag-2::cMyc + rol-6(su1006)].  Rollers.  Extrachromosomal array carrying myc-tagged LAG-2 protein partially rescues lag-2(null).  About 70% of progeny are Lag.  Survivors are Rollers.  Reference: Crittenden et al., Mol Biol Cell. 2006 Jul;17(7):3051-61.