Defective in chemotaxis to Na+, OH-, NaHCO3; partially defective in chemotaxis to CL-; inverted taxis to cAMP.

Defective in chemotaxis to all attractants and to D-tryptophan; partially defective in chemotaxis to CO2(phosphate) and H+(citrate). Thermotaxis weak. p673 previously called tax-3 or daf-21.

Defective in chemotaxis to Na+, Cl-, OH-, NaHCO3, pyridine, cAMP, D-tryptophan; partially defective to CO2(phosphate), H+(phosphate), H+(citrate); a little Small. Thermotaxis is funny.

Defective in chemotaxis to Na+, NaHCO3, pyridine, cAMP, D-tryptophan; partially defective to CO2(phosphate)m H+(phosphate),, H+(citrate); inverted taxis to Cl-, OH-. Progeny yield about 50% of normal. No Thermotaxis. See also WBPaper00002585.

Defective in chemotaxis to all attractants except D-tryptophan. Partially defective in response to pyridine, H+(citrate). Thermotaxis okay.

Pale, scrawny appearance, probably due to starvation. Hyperactive, backs frequently, egg laying constitutive, slow pharyngeal pumping. Probably null (based on sequence, S. Nurrish). Suppresses activated GOA-1 and partially suppresses egl-3(rf). Lethal in combination with eat-16(rf). Previously called sag-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs105 [egl-30::GFP + dpy-20(+)]. Translational fusion contains all of the presumptive 5'-transcriptional regulatory sequences, introns, and presumptive 3 regulatory sequences for egl-30, in addition to the coding sequences for GFP just 5' of the egl-30 initiating methionine. syIs105 was found to partially rescue egl-30(md186) with respect to egg laying, movement, pharyngeal pumping, and response to neurotransmitters in egg-laying assays.

paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. ech-7(et6) suppresses the cold-adaptation defect of paqr-2(tm3410) and partially suppresses the tail tip defect. ech-7(et6); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.

F07C3.4. Homozygous. Outer Left Sequence: ATTCTGGTGGAGAACCAACG. Outer Right Sequence: AACAACTGCTTCCCGAGGTA. Inner Left Sequence: AGGAACATGACGAAAGGCAG. Inner Right Sequence: TGATTCCATCTGGCTCCTTC. Inner primer WT PCR product: 2769. glo-4(ok623) causes a a partially-penetrant Dpy phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

gaIs285 [unc-62(7a)::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. A STOP-codon was inserted into exon 7a of unc-62 to generate an UNC-62(7b)-specific reporter. Recombineered fosmid was integrated by biolistic bombardment to produce strain OP602, which was outcrossed to produce SD1894. glo-4(ok623) causes a a partially-penetrant Dpy phenotype. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org). Derived from parental strains RB811 and SD1888.

wgIs600 [unc-62::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. glo-4(ok623) causes a a partially-penetrant Dpy phenotype. Derived from parental strains RB811 and SD1871.

gaIs286 [unc-62(7b)::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. A STOP-codon was inserted into exon 7a of unc-62 to generate an UNC-62(7b)-specific reporter. Recombineered fosmid was integrated by biolistic bombardment to produce strain OP602, which wa outcrossed to produce SD1894. glo-4(ok623) causes a a partially-penetrant Dpy phenotype. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org). Derived from parental strains RB811 and SD1894.

stIs10453 [elt-2::TGF(7E1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. glo-4(ok623) causes a a partially-penetrant Dpy phenotype.

Variably abnormal. Severe developmental defects. Partially lethal (approx. 2/3 fail to survive). Adult hermaphrodites have variably enlarged and shortened tails and the body cuticle is twisted. Severe egg-laying defect; some animals have a protruding vulva. Tab. Unc. Lack AVM, PVM, and PLM. ALM often fail to migrate or migrate a shorter distance.

popl-5 [S99I]/tmC29 III. Variant edit. Lethal mutation balanced by tmC29. Balancer marked with myo-2p::GFP. Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP popl-5 [S99I] homozygotes (larval lethal), and Unc GFP+ tmC29 homozygotes. Pick fertile wild-type GFP+ to maintain. NOTE: udn113 homozygotes are partially L3 larval lethal: some homozygotes can develop into sterile adults with protruding vulvae. Pick fertile GFP+ to maintain. AvaII site added in S99I allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658

oaSi26 [par-5p::par-5(partially recoded)::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of partially recoded par-5 under its endogenous regulatory sequences to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi30 [par-5p::par-5(partially recoded)::par-5 3' UTR(splice bias) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi31 [par-5p::par-5(partially recoded)::par-5 3' UTR(truncated) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.3 isoform exclusively to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi34 [par-5p::par-5(partially recoded)::par-5 3' UTR(mutated splice sites, mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.1 isoform exclusively to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi37 [par-5p::par-5(partially recoded)::par-5 3' UTR(mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the long PAR-5 3'UTR isoforms (utr.1 and utr.2) to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi40 [par-5p::par-5(partially recoded)::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of partially recoded par-5 fused to GFP under its endogenous regulatory sequences to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3L (long) splice isoform, expressed under control of the lin-3 promoter. The transgene partially rescues lethal and Vulvaless phenotypes (but not sterility) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain.

lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3XL (extra long) splice isoform, expressed under control of the lin-3 promoter. The transgene partially rescues lethality (but not Vulvaless or sterile phenotypes) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain.

Partially penetrant embryonic and larval lethality. Variable morphological defects. Reference: Schmitz C, et al. Dev Biol. 2008 Apr 15;316(2):249-59.

rhIs4 [glr-1p::GFP + dpy-20(+)] III. Lateral axons and ventral cord cross-over defects. Partially penetrant embryonic and larval lethality. Reference: Schmitz C, et al. Dev Biol. 2008 Apr 15;316(2):249-59.

neIs20 [pie-1::3xFLAG::csr-1 + unc-119(+)]. Partially rescues sterility (60% dead embryos). Unknown if unc-119(ed3) is still present in the background. Reference: Claycomb J, et al. 2009 Cell 139:123-34.

neIs20 [pie-1::GFP::csr-1 + unc-119(+)]. Partially rescues sterility (60% dead embryos). Unknown if unc-119(ed3) is still present in the background. Reference: Claycomb J, et al. 2009 Cell 139:123-34.

opIs34 [hus-1p::hus-1::GFP + unc-119(+)]. Low-copy integrated array of 1144 bp hus-1 promoter and genomic coding sequence fused to GFP. Nuclear expression of GFP in germ cells and embryos. Integrated GFP construct completely rescues DNA damage induced cell cycle arrest defect and partially rescues DNA damage induced apoptosis of hus-1(op241).

opIs76 [cyb-1p::cyb-1::YFP + unc-119(+)]. The fusion protein partially rescues a cyb-1 null allele, so it is at least partially functional. non-Unc strain.

n1790 causes a partially penetrant "rod-like" larval lethal phenotype (17% at 20C) and a partially penetrant vulvaless defect (50% at 20C). A Smg mutation enhances these phenotypes. The n1790 mutation is a nonsense change at codon 352.

3xflag::gfp inserted into endogenous wago-4 locus using CRISPR/Cas9 engineering. 3xFLAG::GFP::WAGO-4 is partially functional in this strain. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.

RNAi deficient (Rde). Him. Partially-inaccurate paring of meiotic chromosomes. fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.