More Fields
Strain Species Genotype
JK3476 C. elegans ceh-22(q632) sma-1(e30) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. Segregates Sma, GFP- worms which have partially penetrant gonadogenesis defects. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3744 C. elegans qIs89. Show Description
qIs89 [gon-14::gon-14::VENUS + S. cerevisiae DNA]. gon-14::VENUS is broadly expressed in cell nuclei starting at the 50-100 cell stage of embryogenesis and throughout larval development. Partially concentrated in nuclear speckles. qIs89 rescues the 25C Gon and Ste defects of q686. Low penetrance of sterility and lethality in the strain. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK4099 C. elegans hlh-2(tm1768) I. Show Description
Temperature sensitive sterile. Partially sterile at 20 C; completely sterile at 25 C. Maintain at <20 C. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK5226 C. elegans glp-1(q46) III; qSi156 IV. Show Description
qSi156 [glp-1::Halotag + Cbr-unc-119(+)] IV. Mos insertion of Halo tagged GLP-1 in glp-1(null) background. qSi156 mostly rescues glp-1(q46) sterility; partially penetrant embryonic lethality, early larval lethality and dumpiness. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
JPS346 C. elegans slo-1(js379)V; vxEx346. Show Description
vxEx346 [slo-1p::hslo(D362/367A + 5D5N)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Partially resistant to ethanol and crooked neck phenotype. vxEx346 expresses human BK channel protein (hslo(D362/367A + 5D5N)) with compromised calcium-sensing residues and a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS360 C. elegans slo-1(js379)V; vxEx360. Show Description
vxEx360 [slo-1p::slo-1(D391/396A)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Partially crooked neck phenotype. vxEx360 expresses worm BK channel protein (slo-1(D391/396A)) with purported calcium-sensing residues in the RCK1 domain compromised and a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JR1279 C. elegans cep-1(+) I; cep-1(w40). Show Description
Resistant to germ cell death induced by ionizing radiation. Sensitive to hypoxia and starvation stresses. This strain contains an intact copy of the gene at the normal locus on LG I. w40 is a translocated partially deleted copy of the cep-1 locus that has a dominant-negative effect on cep-1 function and is not linked to the chromosomal location of cep-1.
KK1228 C. elegans pkc-3(it309[GFP::pkc-3]) II. Show Description
Superficially wild-type. Note that double homozygous mutants of pkc-3(it309) with par-2(it315) exhibited partially penetrant and variable maternal effect lethality and maternal effect sterility that was stronger than it315 alone. Thus, although the GFP tag on pkc-3 shows no effect in an otherwise wild-type background, it does seem to somewhat compromise the activity of the protein it tags. Made in N2 background.
KK1254 C. elegans par-2(it315[mCherry::par-2]) III. Show Description
par-2(it315) exhibits a weak maternal effect sterility, suggesting that the tag reduces the protein activity. Note, however, that double homozygous mutants of it315 with pkc-3(it309) or par-6(it310) exhibited partially penetrant and variable maternal effect lethality and maternal effect sterility that was stronger than it315 alone. Thus, although the GFP tags on pkc-3 and par-6 show no effect in an otherwise wild-type background, they do seem to somewhat compromise the activity of the proteins they tag. Made in N2 background.
LX2071 C. elegans goa-1(sa734) I; vsSi32 III. Show Description
vsSi32 [goa-1::GFP + unc-119(+)] III. GOA-1::GFP translational fusion driven by 5kb of goa-1 promoter. Rescues locomotion and body morphology defects, and partially rescues egg-laying defects seen in goa-1 null mutants. vsSi32 is inserted into the left arm of chromosome III between sequences 5’-tttactgcatactgaacaacaggggaaaagggg-3’ and 5’-tagaattagctgtaagacggcgtctaggttttgca-3’. Reference: Kumar S, et al. G3 (Bethesda). 2021 Aug 7;11(8):jkab167. doi: 10.1093/g3journal/jkab167. PMID: 34003969
MLC1016 C. elegans nDf50 nDf49 II; lucIs20. Show Description
lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. Position of integrated transgene unknown (not on X). mir-35 family mutant expressing a mirtron-version of mir-35. nDf50 nDf49 mutants are partially rescued by expression of mirtron-35 from integrated transgene; mild mir-35-related phenotypes are more severe at elevated temperatures. Strain is derived from injection into parental strain MT14533. Position of integrated transgene unknown (not on X). Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
MP125 C. elegans unc-8(n491) sup-41(lb125) IV; deg-1(u38) X. Show Description
Animals move sluggishly but are able to back, despite n491. lb125 also partially suppresses the tail touch insensitive phenotype of u38 in cold-sensitive fashion: at 25C -> 0%; at 20C -> 5%; at 15C -> 30%.
MQ200 C. elegans mud-1(qm21) III. Show Description
Maternal effect Uncoordinated and Dumpy. High degree of embryonic and larval lethality. Dpy phenotype only partially resuced. Hatchlings are of variable length, with poor movement. Adults are short and show kinky uncoordination.
MQ210 C. elegans mau-4(qm45) X. Show Description
Maternal effect uncoordinated. Stiff posterior body. Severly Unc when attempting to move backwards. Partially wasted posterior body. Some embryonic and larval lethality.
MQ468 C. elegans hmp-2(qm39) I. Show Description
Maternally rescued Dpy. Fully zygotically rescued but only partially maternally rescued. Some embryonic lethality and a high degree of larval lethality. Very poor embryonic elongation. Hatchlings are short and deformed. In later stages the anterior half of the body is short but well developed while the posterior is thin.
MT1205 C. elegans egl-7(n575) III. Show Description
Egg laying defective. Retains late stage eggs. Partially temperature sensitive. Semidominant.
MT1215 C. elegans egl-20(n585) IV. Show Description
Egg laying defective. Retains late stage eggs. partially ts
MT1217 C. elegans egl-11(n587) V. Show Description
Egg laying defective. Retains late stage eggs. Partially temperature sensitive.
MT14119 C. elegans nDf50 II. Show Description
Partially penetrant embryonic lethal phenotype. mir-35 though mir-41 are deleted in nDf50. Deletion breakpoints are: TGGTTTCTTCCACAGTGGTACTTTCCATTA / GAACTATCACCGGGT...GGGTCAAATGTTTATA / CAGTTGTGCTACTAAACGTATTGTTACACG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14390 C. elegans let-418(n3536) V. Show Description
Temperature sensitive allele of let-418. Viable at 20C. Sterile and partially Muv at 22.5C. Larval lethal at 25C.
MT155 C. elegans egl-32(n155) I. Show Description
Egg laying defective. Retains late stage eggs. Forms bags of worms. Partially temperature sensitive. Males mate.
MT3571 C. elegans osm-8(n1518) II. Show Description
Partially osmotic avoidance defective. Recessive. FITC filling normal.
MT7949 C. elegans lin-1(n1761) IV. Show Description
n1761 cuases a partially penetrant "rod-like" larval lethal phenotype (70% at 20C) and a partially penetrant vulvaless phenotype (30% at 20C). It is a splice site defect predicted to eliminate 62 amino acids at the C-terminus.
NH2531 C. elegans let-60(ay75)/dpy-20(e1362) IV. Show Description
ay75gf: ts dominant Clr, Sterile; Dominant sterile at 25C, fertile at 15C, severely reduced fertility at 20C. At 15C, ay75gf: recessive adults Clr, partially penetrant Muv. At 15C, heterozygotes segregate 50% WT, 25% Dpy, and 25% adult Clear.
NM2040 C. elegans dhc-1(js121) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); jsIs37 V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Heterozygotes are GFP+ in the pharynx. dhc-1 homozygotes are GFP- and sterile or partially sterile pvuls. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP js121 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
NW1313 C. elegans mig-6(ev700) V. Show Description
Abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Partially penetrant embryonic arrest and early larval lethal.
NW1314 C. elegans mig-6(ev701) V. Show Description
Abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Partially penetrant embryonic arrest and early larval lethal.
NW1623 C. elegans dpy-11(e224) mig-6(ev788) V/eT1 (III;V). Show Description
Heterozygotes display partially penetrant (~10%) abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Heterozygotes segregate WT, abnormal DTC migration, Unc, and dead eggs. Maintain by picking wild-type.
OC100 C. elegans zyg-1(it25) II; sun-1(bs12) szy-18(b53) V. Show Description
bs12 and bs53 partially suppress zyg-1. Grow at 20C.
OC188 C. elegans zyg-1(it25) szy-16(bs36) II. Show Description
it24 is temperature sensitive; produces maternal effect embryonic lethal phenotype (Mel) after shoft to 24C at L4 stage. Mel is partially suppressed by bs36 at 24C. Reference: Kemp C, et al. (2007) Genetics 176:95-113.
OC199 C. elegans zyg-1(it25) sds-22(bs9) II. Show Description
it24 is temperature sensitive; produces maternal effect embryonic lethal phenotype (Mel) after shoft to 24C at L4 stage. Mel is partially suppressed by bs9 at 24C. sds-22 previously called szy-6. Reference: Kemp C, et al. (2007) Genetics 176:95-113.
OC202 C. elegans zyg-1(it25) II; szy-12(bs16) V. Show Description
zyg-1(it25) EMB partially suppressed at 24C.
OC204 C. elegans zyg-1(it25) dpl-1(bs21) II. Show Description
it24 is temperature sensitive; produces maternal effect embryonic lethal phenotype (Mel) after shoft to 24C at L4 stage. Mel is partially suppressed by bs21 at 24C. szy-10(bs21) has a partially penetrant embryonic lethal phenotype at all temperatures. Reference: Kemp C, et al. (2007) Genetics 176:95-113.
OC248 C. elegans zyg-1(it25) II; szy-11(bs22) V. Show Description
Maternal-effect embryonic lethal (L4 shift up) of zyg-1(it25) partially suppressed by szy-11(bs22).
OH1487 C. elegans hse-5(tm472) III. Show Description
Partially penetrant sluggish. tm472 removes 1249nt following 15974 in B0285 (Acc#34533) and inserts an adenosine at position 17228. Putative molecular null allele.
OH3754 C. elegans otIs114 I; fozi-1(ot159) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
OH3900 C. elegans otIs114 I; fozi-1(ot191) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
OH3962 C. elegans otIs114 I; fozi-1(ot236) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
OH4027 C. elegans otIs114 I; fozi-1(ot234) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
OH707 C. elegans cog-1(ot38)/+ II; otIs114 I. Show Description
otIs114 [lim-6::GFP + rol-6(su1006)]. Rollers. Heterozygous strain. Heterozygotes should be fertile and segregate some sterile progeny. Maintain by picking plenty of animals with GFP in both ASEL and ASER; many of them will be sterile (homozygotes). otIs114 is normally expressed only in ASEL and excretory gland cell. Homozygous ot38; otIs114 is sterile and expresses GFP in both ASEL and ASER neurons. Heterozygotes display a semi-dominant, partially penetrant "ASEL + ASER" phenotype.
OK245 C. elegans pyr-1(cu8) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles (mnC1 homozygotes), and Unc-4 animals which have a partially penetrant Mel phenotype.
OK286 C. elegans pyr-1(cu8) II. Show Description
Partially penetrant Mel.
PD8117 C. elegans smg-1(cc545) unc-54(r293) I. Show Description
Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C.
PD8118 C. elegans smg-1(cc546) unc-54(r293) I. Show Description
Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C.
PR671 C. elegans tax-2(p671) I. Show Description
Defective in chemotaxis to Na+, Cl-, OH-, NaHCO3, pyridine, cAMP, D-tryptophan, CO2(phosphate). Partially defective in chemotaxis to H+(phosphate). Slightly inverted taxis to H+(citrate). Thermotaxis defective too.
PR672 C. elegans che-1(p672) I. Show Description
Defective in chemotaxis to Na+, OH-, NaHCO3; partially defective in chemotaxis to CL-; inverted taxis to cAMP.
PR673 C. elegans hsp-90(p673) V. Show Description
Defective in chemotaxis to all attractants and to D-tryptophan; partially defective in chemotaxis to CO2(phosphate) and H+(citrate). Thermotaxis weak. p673 previously called tax-3 or daf-21.
PR675 C. elegans tax-6(p675) IV. Show Description
Defective in chemotaxis to Na+, Cl-, OH-, NaHCO3, pyridine, cAMP, D-tryptophan; partially defective to CO2(phosphate), H+(phosphate), H+(citrate); a little Small. Thermotaxis is funny.
PR678 C. elegans tax-4(p678) III. Show Description
Defective in chemotaxis to Na+, NaHCO3, pyridine, cAMP, D-tryptophan; partially defective to CO2(phosphate)m H+(phosphate),, H+(citrate); inverted taxis to Cl-, OH-. Progeny yield about 50% of normal. No Thermotaxis. See also WBPaper00002585.
PR696 C. elegans che-1(p696) I. Show Description
Defective in chemotaxis to all attractants except D-tryptophan. Partially defective in response to pyridine, H+(citrate). Thermotaxis okay.