More Fields
Strain Species Genotype
VC1171 C. elegans parp-2(ok344) II. Show Description
E02H1.4. 1576 bp deletion. Flanking sequences: GAGGAACCGGAACCTGAGCCGAAAGTTGAT TTAAACCTGTTAATCCAATGATACTCCTCA. External left primer: CCGCAGTACACCTTAGCCTC. External right primer: ATCCTGCTCGTCAAGCATCT. Internal left primer: GTGAAAGCCTGGAGAGCAAG. Internal right primer: ACGACACTTCAGATGGGCTT. Internal primer WT PCR product: 2610. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807