More Fields
Strain Species Genotype
YA911 C. elegans ypT34 (III;X). Show Description
X-autosome chromosome fusion. IIIL and XR telomeres are fused. Generated in a trt-1(ok410); lig-4(tm750) mutant N2 background. Although outcrossed, ok410 or tm750 deletions might still be present in the background. Reference: Lowden M, et al. Genetics. 2008 Oct;180(2):741-54. doi: 10.1534/genetics.108.089920. PMID: 18780750.
YA920 C. elegans ypT21 (IV;X) Show Description
X-autosome chromosome fusion. IVR and XR telomeres are fused. Generated in a trt-1(ok410) mutant N2 background. Although outcrossed, ok410 might still be present in the background. Reference: Lowden M, et al. Genetics. 2008 Oct;180(2):741-54. doi: 10.1534/genetics.108.089920. PMID: 18780750.
YC256 C. elegans dcar-1(nj66) V. Show Description
Defective avoidance to water-soluble repellent. Reference: Aoki R., et al. J Neurosci. 2011 Nov 16;31(46):16603-10.
YC307 C. elegans dcar-1(tm2484) V. Show Description
Defective avoidance to water-soluble repellent. Reference: Aoki R., et al. J Neurosci. 2011 Nov 16;31(46):16603-10.
YEW1 Oscheius carolinensis Oscheius carolinensis. Show Description
Male-female strain. Isolated in July 2008 in Raliegh, NC in vermicompost by Yasmin Cardoza. Isolated from Galleria mellonella (great wax moth). It can be maintained at 20C. Called Ral4a.
YH461 C. elegans ifta-2(tm1724) IV. Show Description
Extended life span. daf-d.
YK31 C. elegans tbx-9(ms31) III. Show Description
Deletion of 3.0 kb of the genomic region that extends from 2.1 kb upstream to the middle of the tbx-9 gene. Incompletely penetrant morphogenic defects in embryogenesis. Failure in proper formation of hypodermis and body-wall muscle.
YL139 C. elegans meg-1(vr10) X. Show Description
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: AGATGCCACATACAAACGCT / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306.
YL140 C.elegans meg-1(vr11) X. Show Description
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: CAGTTCCAAATGAATCAAAG / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306.
YL195 C. elegans pzf-1(vr3) V. Show Description
Superficially wild type.
YM19 C. elegans cpb-3(bt17) I. Show Description
Slightly slow growth. Almost sterile at 25C. Grow at 15-20C.
YT17 C. elegans crh-1(tz2) III. Show Description
Clumpy, pale and slightly small, tend to dig into plate. Daf-c at 27C. Do not distribute this strain; other labs should request it from the CGC.
YY11 C. elegans dcr-1(mg375) III. Show Description
Enhanced RNAi. Sterile at 25 degrees. Referenced in Pavelec et al. Genetics (2009).
YY160 C. elegans nrde-1(gg88) III. Show Description
eri-1(mg366) has been crossed out of the background. Reference: Burkhart KB, et al. PLoS Genet. 2011 Aug;7(8):e1002249.
YY166 C. elegans ergo-1(gg98) V. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
YY168 C. elegans ergo-1(gg100) V. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
YY169 C. elegans ergo-1(gg102) V. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
YY216 C. elegans eri-9(gg106) III. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
YY453 C. elegans nrde-4(gg129) IV. Show Description
Reference: Burkhart KB, et al. PLoS Genet. 2011 Aug;7(8):e1002249.
YY470 C. elegans dcr-1(mg375) III. Show Description
Enhanced RNAi response. Sterile at 25 C. Outcrossed from YY11; wild-type for mut-16. Superficially wild-type.
ZB1028 C. elegans crt-1(bz29) V. Show Description
Probably null calreticulin. W28 amber. Slow growth (one day developmental delay). Nearly sterile if raised at 25C. Suppresses mec-4(d)-induced neurodegeneration. Bent-head.
ZB1029 C. elegans crt-1(bz30) V. Show Description
Probably null W231opa. Probably null calreticulin - slow growth (one day developmental delay). Nearly sterile if reared at 25C. Suppresses mec-4(d)-induced neurodegeneration. Bent-head.
ZB1030 C. elegans crt-1(bz31) V. Show Description
Point mutation C133Y. No easily detected phenotype, selected for suppression of mec-4(d)-induced degeneration caused by ectopic expression of mec-4(d)-induced neurodegeneration. Bent-head.
ZB1031 C. elegans crt-1(bz50) V. Show Description
Point mutation in G102E. No easily detected phenotype, selected for suppression of mec-4(d)-induced degeneration caused by ectopic expression of mec-4(u231) in the ventral nerve cord. Bent-head.
ZB2844 C. elegans hpa-1(tm3256) IV. Show Description
Reference: Iwasa H, et al. Aging Cell. 2010 Aug;9(4):490-505.
ZB2845 C. elegans hpa-2(tm3827) II. Show Description
Reference: Iwasa H, et al. Aging Cell. 2010 Aug;9(4):490-505.
ZB547 C. elegans ced-12(bz187) I. Show Description
Induces persistence of programmed cell death corpses and necrotic cell death corpses.
ZD1866 C. elegans eif-2a(qd338) I. Show Description
Y37E3.10. qd338 disrupts Ser49 phosphorylation site; suppresses daf-28(sa191) constitutive dauer entry phenotype. Reference: Kulalert W, et al. Genetics 2017. In press.
ZD2005 C. elegans eif-2Ba(qd335) III. Show Description
ZK1098.4. qd335 suppresses daf-28(sa191) constitutive dauer entry phenotype. Reference: Kulalert W, et al. Genetics 2017. In press.
ZD500 C. elegans hecw-1(ok1347) III. Show Description
Pathogen avoidance phenotype. Defective nose touch response.
ZG596 C. elegans hif-1(ia7) V. Show Description
Published in Zhang et al PLoS ONE 4: e6348 (2009).
ZH382 C. elegans unc-108(n3263) I. Show Description
Recessive Unc. Recessive apoptotic cell removal defect. Recessive phagosome maturation defect (inefficient and prolonged phagosome maturation process in embryos). Reference: Mangahas PM, Yu X, and Zhou Z. J Cell Biol. 2008 Jan 28;180(2):357-73.
ZM1079 C. elegans unc-77(hp102) IV. Show Description
Hyperactive coiler. hp102 is a gain-of-function mutation. Reference: Yeh E, et al. PLoS Biol. 2008 Mar 11;6(3):e55. doi: 10.1371/journal.pbio.0060055. PMID: 18336069.
ZM2960 C. elegans nca-2(gk5) III; unc-77(gk9) IV. Show Description
Uncoordinated behaviour. Fainter, pauses quickly after stimulating touch-response by prodding or tapping plate. References: Humphry JA, et al. Curr Biol. 2007 Apr 3;17(7):624-9. Gao S, et al. Nat Commun. 2015 Feb 26;6:6323.
ZM3087 C. elegans unc-9(fc16) unc-7(e5) X. Show Description
Kinkers. References: Yeh E, et al. J Neurosci. 2009 Apr 22;29(16):5207-17. Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.
ZM3360 C. elegans unc-77(hp102) IV; unc-80(hp369) V. Show Description
Fainter. hp369 is an early nonsense mutation in unc-80 and was isolated as a suppressor of unc-77(hp102). Reference: Yeh E, et al. PLoS Biol. 2008 Mar 11;6(3):e55. doi: 10.1371/journal.pbio.0060055. PMID: 18336069.
ZM607 C. elegans syd-2(ok217) X. Show Description
Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).
ZM6523 C. elegans hpDf761 II; unc-119(ed3) III. Show Description
hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM6539 C. elegans unc-39(hp701) V. Show Description
Sluggish, somewhat loopy. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
ZM6660 C. elegans got-1.2(hp731) X. Show Description
got-1.2(hp731) is C184Y substitution mutation. Reference: Chitturi J, et al. PLoS Genet. 2018 Apr 12;14(4):e1007303. doi: 10.1371/journal.pgen.1007303. PMID: 29649217.
ZM7963 C. elegans hpDf761 II; daf-28(tm2308) V. Show Description
Temperature-sensitive Daf-c. Maintain at 15C. hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. Development. 2014 Apr;141(8):1767-79.
ZM8202 C. elegans ubr-1(hp821 hp833) I. Show Description
Stiff backing. Presumptive null. This strain carries two CRISPR-engineered deletions to ensure complete knockout of ubr-1 function. hp821 is a deletion in the 5 ' end of ubr-1 and hp833 is a deletion near the 3' end of the gene. Reference: Chiturri J, et al. PLoS Genet. 2018 Apr 12;14(4):e1007303. doi: 10.1371/journal.pgen.1007303. eCollection 2018 Apr. PMID: 29649217.
ZM8302 C. elegans twk-40(hp834) III. Show Description
Loss-of-function allele. Loopy movement with increased reversals.
ZM8958 C. elegans hpIs569. Show Description
hpIs569 [unc-4::Chrimson::wCherry + lin-15(+)]. Marker for optogenetic stimulation in A-class (A-MNs) and other motor neurons. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
ZM9040 C. elegans unc-2(hp647) X. Show Description
Hyperactive. Frequent alternation between forward and backward locomotion (shuttling). hp647 is a is a gain-of-function mutation identified as a suppressor of the 'fainter' motor defects of unc-80(e1069) mutants. Reference: Gao S, Elife. 2018 Jan 23:7:e29915. doi: 10.7554/eLife.29915. PMID: 29360035.
ZR2 C. elegans jmjd-3.1(gk384) X. Show Description
Gonadal enlargement and aberrant gonad migration. Phenotype evident at 25C.
ZT22 C. elegans fjSi1 II; csr-1(fj54) IV. Show Description
fjSi1 [2×FLAG::csr-1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×FLAG::csr-1 transgene was designed to express proteins with a double FLAG tag instead of the N169 of CSR-1a and N6 of CSR-1b. The linker sequence between the two FLAG tags has a NotI site. The insertion can be checked by PCR with the following primers: CACACTCGATTCTACGCCAA (at the 3'-side of csr-1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT24 C. elegans vsra-1(tm1637) I; fjSi3 II. Show Description
fjSi3 [HA_2×FLAG::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The HA_2×FLAG::C04F12.1 transgene was designed to express a protein with an HA tag and a double FLAG tag inserted after S21 of C04F12.1. The linker sequence between the HA tag and the double FLAG tag has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT34 C. elegans cec-8(fj63) III; cec-4(ok3124) cec-5(fj58) IV. Show Description
Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT35 C. elegans cec-8(fj63) III; cec-4(ok3124) cec-5(fj61) him-8(e1489) IV. Show Description
Maintain at 20C or lower. Him. The cec-8; cec-4 cec-5 him-8 quadruple mutant exhibits partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.