VT191 |
C. elegans |
+/szT1 [lon-2(e678)] I; dpy-6(e14) lin-14(n536) maDf1/szT1 X. Show Description
|
|
VT192 |
C. elegans |
+/szT1 [lon-2(e678)] I; dpy-6(e14) lin-14(n536) maDf2/szT1 X. Show Description
|
|
VT2812 |
C. elegans |
unc-54(e190) I; mir-83(n4638) IV; mir-34(gk437) X. Show Description
Paralyzed. DTC migration defect. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3289 |
C. elegans |
mir-83(n4638) IV; mir-34(gk437) X. Show Description
DTC migration defects. Generated from VT3106 and VT3110. VC3289 has the genotype as VT2595 but made from different parental strains. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3301 |
C. elegans |
mir-794 mir-795(maDf5) I. Show Description
mir-794 mir-795(maDf5) enhances retarded phenotypes of mir-48 mir-241 (nDF51). maDf5 allele is missing the 1312 nucleotide region between ATACATATTCCGAGAAACGTTACCT and GTGAGGCGCCAAATGCCGGCCTCAC [chrI:12,594,556-12,595,917 of WBcel235/ce11].
|
|
VT333 |
C. elegans |
+/szT1 [lon-2(e678)] I; dpy-17(e164) III; dpy-6(e14) lin-14(n536) maDf2/szT1 X. Show Description
Heterozygotes are Dpy and segregate Dpy, males and dead eggs.
|
|
VT3650 |
C. elegans |
lin-46(ma398[lin-46::mCherry]) V. Show Description
mCherry reporter inserted into C-terminus of endogenous lin-46 locus. Superficially wild-type. Fluorescent signal is very dim and bleaches very quickly. Reference: Ilbay O, et al. C. elegans LIN-28 controls temporal cell-fate progression by regulating LIN-46 expression via the 5UTR of lin-46 mRNA. bioRxiv 697490; doi: https://doi.org/10.1101/697490.
|
|
VT454 |
C. elegans |
maDf4/dpy-10(e128) unc-104(e1265) II. Show Description
Heterozygotes are WT (slightly Dpy) and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
|
|
VT509 |
C. elegans |
lin-4(e912) II; maEx114. Show Description
maEx114 [lin-4(+) + rol-6(su1006)]. Pick Rollers to maintain. lin-4 loss-of-function is rescued by the maEx114 extrachromosomal array expressing lin-4 microRNA. Reference: Lee RC, et al. Cell. 75, 843-854.
|
|
VT516 |
C. elegans |
lin-29(n546)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are slightly shorter than WT and segregate DpyUnc and Egl.
|
|
VT573 |
C. elegans |
lin-4(e912) II; lin-14(n179) X. Show Description
lin-14(n179) is temperature-sensitive. lin-4; lin-14 double mutant may be maintained at 20C.
|
|
VT581 |
C. elegans |
dpy-5(e61) lin-28(n719) I; lin-46(ma164) unc-76(e911) V. Show Description
Dpy Unc. Egl+. lin-46 suppresses precocious Egl- phenotype of lin-28. lin-46 alone makes gaps in adult alae; enhanced at 15C.
|
|
VT664 |
C. elegans |
lin-28(n719) I; nIs2 IV. Show Description
nIs2 [lin-11::lacZ + lin-11(+)] IV. Egl. Integrated on IV near dpy-20.
|
|
VT723 |
C. elegans |
lin-28(n719) I; lin-3(e1417) IV. Show Description
Egl. Vulvaless due to lin-3. Precocious VPC divisions and adult alae due to lin-28.
|
|
VT847 |
C. briggsae |
Show Description
C. briggsae wild type strain collected in Hawaii.
|
|
VV207 |
C. elegans |
ser-7(vq2) X. Show Description
CRISPR/Cas9-engineered knockout of ser-7. Resistant to exogenous serotonin induced food intake. Reference: Perez-Gomez A., et al. Nat Commun. 2018 Dec 10;9(1):5272.
|
|
VV212 |
C. elegans |
ser-5(vq1) I. Show Description
CRISPR/Cas9-engineered knockout of ser-5. Resistant to antipsychotic induced food intake. Reference: Perez-Gomez A., et al. Nat Commun. 2018 Dec 10;9(1):5272.
|
|
VV213 |
C elegans |
Y53F4B.18(vq3) II. Show Description
Superficially wild-type. Reference: Chen AL, et al. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0243-4.
|
|
VZ12 |
C. elegans |
trxr-2(tm2047) III. Show Description
Superficially wild-type. tm2047 removes bases -128 to +380 relative to the start of the trxr-2 coding sequence (removing part of the proximal promoter). Reference: Cacho-Valdez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
|
|
VZ13 |
C. elegans |
trx-2(tm2720) V. Show Description
Superficially wild-type. Reference: Cacho-Valdez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
|
|
VZ14 |
C. elegans |
trxr-2(tm2047) III; trxr-1(sv47) IV. Show Description
sv47 deletion removes bases 721-2383 of the trxr-1 genomic sequence (as measured from the start of the trxr-1 coding sequence). tm2047 removes bases -128 to +380 relative to the start of the trxr-2 coding sequence (removing part of the proximal promoter). tm2047 outcrossed 6x. sv47 outcrossed 10x. Reference: Cacho-Valadez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
|
|
VZ15 |
C. elegans |
trxr-2(ok2267) III. Show Description
Superficially wild-type. ok2267 removes bases +114 to 1751 relative to the start of the trxr-2 coding sequence. Reference: Cacho-Valdez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
|
|
VZ17 |
C. elegans |
trxr-2(tm2047) III; trx-2(tm2720) V. Show Description
Superficially wild-type. Reference: Cacho-Valdez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
|
|
VZ22 |
C. elegans |
trxr-2(ok2267) III; trx-2(tm2720) V. Show Description
Superficially wild-type. ok2267 removes bases +114 to 1751 relative to the start of the trxr-2 coding sequence. Reference: Cacho-Valdez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
|
|
VZ54 |
C. elegans |
glrx-21(tm2921) III. Show Description
Superficially wild-type. Hypersensitive to selenium-induced motility impairment, but not lethality. Reference: Morgan KL, et al., Toxicol Sci. 2010 Dec;118(2):530-43.
|
|
VZ68 |
C. elegans |
trx-3(tm2820) IV. Show Description
Superficially wild-type. Reference: Jiménez-Hidalgo M, et al. Free Radic Biol Med. (2014) 68:205-219.
|
|
WE5236 |
C. elegans |
pgIR1 (I, CB4856>N2) I. Show Description
pgIR1 (I, CB4856>N2). CB4856 Chromosome I in N2 background.
|
|
WF1131 |
C. elegans |
cam-1(gm105) II. Show Description
cam-1 hypomorph. Grows best at 15C.
|
|
WF1828 |
C. elegans |
hda-1(cw2) II. Show Description
hda-1(cw2) mutants are viable as homozygotes, although many die as embryos or larvae. Severely uncoordinated with defective vulval development and reduced fertility. Reference: Zinovyeva AY, et al. Dev Biol. 2006 Jan 1;289(1):229-42. PMID: 16313898
|
|
WFK1 |
C. elegans |
hpl-2(ok916) III. Show Description
Maintain at 15-20C. Multivulva (Muv) phenotype at higher temperature.
|
|
WH108 |
C. elegans |
abc-1(oj2) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, dead eggs and abc-1 homozygotes. At 25C abc-1 homozygotes are sterile Unc animals. At 16C abc-1 homozygotes are fertile animals that produce all dead eggs.
|
|
WH163 |
C. elegans |
nDf29/unc-13(e1091) spd-2(oj29) I. Show Description
Heterozygotes are WT and segregate WT, dead eggs and Uncs. At 25C the Unc Spds are Sterile; at 16C the Unc Spds are fertile but produce mostly dead eggs. Unc Spd animals will exhibit a fully penetrant maternal-effect embryonic lethal phenotype if shifted to 25C at the L4 stage. unc-13 spd-2 homozygotes may be propagated at 16C but may become sick causing immense frustration! See also WBPaper00004200.
|
|
WH170 |
C. elegans |
eff-1(oj55) II. Show Description
Loss of cell fusion in hypodermis (epithelial fusion failures). Viable and fertile as homozygotes. Tail-spike defect in all young larvae, less visible in older larvae and adults. oj55 appears to cause incomplete loss of function, as many cells fuse in postembryonic development. Homozygous males have tail and mating defects. ES-3. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain.
|
|
WH202 |
C. elegans |
unc-61(n3169) V. Show Description
Poor backward movement. Protrusive vulva. Gonad extrusion. Egg-laying defects. Recessive.
|
|
WH515 |
C. elegans |
chin-1(tm1909)/sC1 [dpy-1(s2170) let(gk597)] III. Show Description
Maintain under normal conditions. Heterozygotes are WT, and segregate WT, occasional Dpy (non-let recombinant sC1 homozygotes), and nearly sterile tm1909 homozygotes. Pick WT and check for correct segregation of progeny to maintain. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.
|
|
WHY10 |
C. elegans |
glh-1(how3[3xHA::TurboID::glh-1]) I. Show Description
3xHA::TurboID tag inserted at the N-terminus of the endogenous GLH-1. TurboID::GLH-1 promiscuously labels proteins at 20C. Transgene generated in N2 background. Reference: Price I, et al. ELife. 2021 Nov 3;10:e72276. doi: 10.7554/eLife.72276.
|
|
WHY546 |
C. elegans |
WHY546 attf-6(how52[attf-6::3xflag]) I. Show Description
3xFlag tag inserted at the C-terminus of the endogenous attf-6 locus. Reference: Wang Y, et al. Nucleic Acids Research. 2025 Feb 28; 53(4): gkaf079. doi: 10.1093/nar/gkaf079 PMID: 39945323.
|
|
WJA1025 |
C. elegans |
rps-10(srf1025[rps-10::3xHA]) I. Show Description
3xHA tag inserted at C-terminus of endogenous rps-10 locus. Some growth defects on its own, which can be exacerbated in conjunction with mutants of no-go mRNA decay factors. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
|
|
WJA1190 |
C. elegans |
rps-20(srf1190[rps-20::3xFLAG]) I. Show Description
3xHA tag inserted at C-terminus of endogenous rps-20 locus. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
|
|
WM100 |
C. elegans |
cks-1(ne549) IV. Show Description
Maintain at 15C. Produces dead eggs at 25C.
|
|
WM101 |
C. elegans |
unc-24(e138) oma-1(ne411) IV; lon-2(e678) X. Show Description
Lon. Maintain at 15C. Produces dead eggs at 25C.
|
|
WM102 |
C. elegans |
oma-1(ne3800) IV. Show Description
Maintain at 15C. Produces dead eggs at 25C.
|
|
WM103 |
C. elegans |
unc-5(e53) mbk-2(ne3442) IV. Show Description
Unc. Maintain at 15C. Produces dead eggs at 25C.
|
|
WM104 |
C. elegans |
unc-101(sy216) gsk-3(nr2047)/hIn1 [unc-54(h1040)] I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc, and coilers which give only dead eggs (low brood size).
|
|
WM126 |
C. elegans |
sago-2(tm894) ppw-1(tm914) I; C06A1.4(tm887) wago-4(tm1019) II; M03D4.6(tm1144) IV; sago-1(tm1195) V. Show Description
Deficient in germline and somatic RNAi.
|
|
WM155 |
C. elegans |
ppw-2(tm1120) I. Show Description
Germline RNAi deficient.
|
|
WM161 |
C. elegans |
prg-1(tm872) I. Show Description
Temperature sensitive. Sterile at 25C. Maintain at 20C or below.
|
|
WM162 |
C. elegans |
prg-2(tm1094) IV. Show Description
|
|
WM170 |
C. elegans |
unc-4(e120) pir-1(tm1496)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and Unc-4 animals which arrest at the L4 stage. Rarely, a recombination will occur and unc-4 and pir-1 will become unlinked. Propagate the strain by picking single WT animals and checking for correct segregation of progeny. 6/2007: Daniel Chavez notes that tm1496 may also delete part of sec-5, which could be responsible for the developmental arrest of tm1496.
|
|
WM179 |
C. elegans |
nmy-2(ne3409) I. Show Description
Isolated from Hawaiian strain CB4856. Temperature sensitive embryonic lethal. Cytokinesis failure and polarity defects at 25C. Maintain at 15C. RNAi sensitive.
|
|