More Fields
Strain Species Genotype
OH1003 C. elegans eno-9(ot9) oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
OH15422 C. elegans ceh-14(ot900) X. Show Description
Null allele generated by gRNAs targeted to the first and last exons of ceh-14, resulting in a 4061bp deletion from +35 to +4098 relative to the start of the ORF.
OH15439 C. elegans ceh-34(ot903[ceh-34::mNG::3xFLAG::AID*]) V. Show Description
CRISPR/Cas9-engineered insertion of mNeonGreen::3xFLAG::AID* tags into endogenous ceh-34 locus. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH15566 C. elegans inx-2(ot906 [inx-2::SL2::NLS::yfp::H2B]) X. Show Description
inx-2(ot906) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-2 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15568 C. elegans unc-17(ot907[unc-17::mKate2::3xflag]) IV. Show Description
Superficially wild-type. mKate2 and 3xFlag tag added to endogenous unc-17 locus. unc-17::mKate2 labels all cholinergic neurons in the nervous system. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078.
OH15579 C. elegans che-1(ot908 ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. Show Description
ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision).
OH15732 C. elegans mab-3(ot931[mab-3::GFP::3xFlag]) II; him-5 (e1490) V. Show Description
GFP and 3xFlag tag inserted in endogenous mab-3 locus using the CRISPR SEC cassette (Dickinson 2015). sgRNA: ggtcaaaattatagatctt Insertion site: II: 9737290-9737291. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078.
OH15733 C. elegans dmd-3(ot932[dmd-3::GFP::3xFlag]); him-8 (e1489) IV. Show Description
GFP and 3xFlag tag inserted in endogenous dmd-3 locus using the CRISPR SEC cassette (Dickinson 2015). sgRNA: accctttcagccgtattgt Insertion site: V: 19650564-19650565. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078.
OH15814 C. elegans him-5(e1490) V; dmd-4(ot935[dmd-4::GFP]) X. Show Description
GFP tag inserted into endogenous dmd-4 locus to create a C-terminal translational GFP fusion.
OH15815 C. elegans che-1(ot63 ot941[che-1::SEC-GFP::TEV::3xFLAG]) I. Show Description
ot941[che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying ot63 null alllele and tagged with GFP (che-1::SEC-GFP::TEV::3xFLAG). che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.
OH15876 C. elegans pha-4(ot946[pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous pha-4 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Please contact Oliver Hobert prior to publishing work using this strain.
OH15908 C. elegans him-5(e1490) V; dmd-4(ot957ot935) X. Show Description
CRISPR-engineered deletion in dmd-4(ot935[dmd-4::GFP]) removing +3201 to +3710 relative to start codon. Partial removal of intron 3 results in loss of somatic nervous system expression without affecting pharyngeal expression.
OH15910 C. elegans lin-11(ot958[lin-11::GFP::FLAG]) I. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous lin-11 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH15912 C. elegans vab-7(ot959[vab-7::GFP::FLAG]) III. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous vab-7 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
OH16020 C. elegans exc-7(ot970[exc-7::gfp]) II. Show Description
Superficially wild-type. GFP inserted into endogenous exc-7 locus by CRISPR/Cas9. Reference: Pham K & Hobert O. MicroPubl Biol. 2019; 2019: 10.17912/micropub.biology.000189.
OH16024 C. elegans daf-16(ot971[daf-16::GFP]) I. Show Description
CRISPR allele of daf-16, tagged at the C-terminus with GFP. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology.
OH16029 C. elegans daf-16(ot975[daf-16::mNeptune2.5::AID*]) I. Show Description
CRISPR allele of daf-16, tagged at the C-terminus with mNeptune2.5::AID*. Reference: Aghayeva U, et al. MicroPubl Biol. 2020 Jan 7;2020:10.17912/micropub.biology.000210. doi: 10.17912/micropub.biology.000210. PMID: 32550509
OH16047 C. elegans eat-5(ot980[eat-5::GFP]) I. Show Description
GFP tag with 6x GS linker inserted at C-terminus of endogenous eat-5 locus.
OH16111 C. elegans unc-42(ot986[unc-42::gfp]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous unc-42 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Berghoff EG, et al. Elife. 2021 Jun 24;10:e64903. doi: 10.7554/eLife.64903. PMID: 34165428
OH16508 C. elegans daf-16(ot975[daf-16::mNeptune2.5::3xFlag::AID*]) I; daf-2(e1370) III; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH17064 C. elegans daf-16(ot971[daf-16::GFP]) otDf2 I. Show Description
otDf2 is a 25,484 bp deletion of the insulin cluster from Chr I, removing ins-28, ZC334.13, ins-29, ins-25, ins-27, linc-124, ZC334.12, ZC334.17, ins-24, ins-30, and ins-26. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508.
OH18320 C. elegans ins-18(ot1326) daf-16(ot971[daf-16::GFP]) I. Show Description
ot1326 is CRISPR-engineered 2,029 bp deletion removing the entire ins-18 coding region. Sequence after edit: AGCTCATTTTAATTTAACACAATGGTCCACCGACTACGTGGAAGATCTTCTTGCCTACTGTGCCCCAATT. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508.
OH18508 C. elegans daf-16(ot971[daf-16::GFP]) I; ins-1(ot1360) IV. Show Description
ot1360 is CRISPR-engineered 1,339 bp deletion removing the entire ins-1 coding region. Sequence after edit: TTATAGGGCATTTTTCAGTTCCTCACCGCTCTCAAATCAGGTCAATATCGTTGGCAGCTCACCGGACCCT. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508.
OH9016 C. elegans ntIs1 V; lsy-2(ot90) X. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. Loss of ASEL fate. 2 cells GFP+ for ASER marker.
PHX5755 C. elegans pha-4(ot946 ot1078 syb5755[pha-4::3xGAS::GFP::3xGAS::AID*::TEV::LoxP::3xFLAG]) V. Show Description
Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID* after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain.