More Fields
Strain Species Genotype
VC1171 C. elegans parp-2(ok344) II. Show Description
E02H1.4. 1576 bp deletion. Flanking sequences: GAGGAACCGGAACCTGAGCCGAAAGTTGAT TTAAACCTGTTAATCCAATGATACTCCTCA. External left primer: CCGCAGTACACCTTAGCCTC. External right primer: ATCCTGCTCGTCAAGCATCT. Internal left primer: GTGAAAGCCTGGAGAGCAAG. Internal right primer: ACGACACTTCAGATGGGCTT. Internal primer WT PCR product: 2610. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2485 C. elegans Y9C9A.16(ok3440) IV. Show Description
Y9C9A.16 Homozygous. Outer Left Sequence: gtcgacagttttcaagtgcg. Outer Right Sequence: ctcgaaaacttccaagtggc. Inner Left Sequence: tgatgcagctgtttttgcat. Inner Right Sequence: tgtcggtggaggtctaatga. Inner Primer PCR Length: 1187. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2486 C. elegans srw-100(ok3441) V. Show Description
Y46H3C.1 Homozygous. Outer Left Sequence: ggaattgagcatgtcaagca. Outer Right Sequence: gggaattcaccgaaaatcaa. Inner Left Sequence: tgccgacatacaacaagttca. Inner Right Sequence: caaatcggcaaatcggtaat. Inner Primer PCR Length: 1117. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2487 C. elegans cca-1(ok3442) X. Show Description
C54D2.5 Homozygous. Outer Left Sequence: tgaacaactgaacaccgagg. Outer Right Sequence: tcaacggtatggctcaaaca. Inner Left Sequence: tgtgcagcaaatcagaacaa. Inner Right Sequence: gcaaggaagaagaaaagcga. Inner Primer PCR Length: 1264. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2488 C. elegans F58G6.1(ok3443) IV. Show Description
F58G6.1 Homozygous. Outer Left Sequence: tttgataaacgctgttggca. Outer Right Sequence: ttcattgcacttttcccctc. Inner Left Sequence: cgaagaatgtgatacgactgtca. Inner Right Sequence: cgcattttcttcattcggtt. Inner Primer PCR Length: 1279. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2489 C. elegans ins-15(ok3444) II. Show Description
F41G3.17 Homozygous. Outer Left Sequence: catccggctttcaatcattt. Outer Right Sequence: gcacatctcactgctccaaa. Inner Left Sequence: gaacggtatccttttcatcca. Inner Right Sequence: atgttctgcaccctgaaacc. Inner Primer PCR Length: 1364. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2763 C. elegans myrf-1(ok3445)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3445 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCGTAGTTTCGGTTATGCC. External right primer: AGCTTTGCTGGTATTGACGG. Internal left primer: TCAAGGACATAAAGAGCTGACA. Internal right primer: GTCAGCAACAGGCAATCAGA. Internal WT amplicon: 1381 bp. Deletion size: 636 bp. Deletion left flank: GAAGACAAGCGGCCATAATGGAAACCAAGG. Deletion right flank: ACAGGGCTCCTCCATTTCGTTGCCATCCAA. Insertion Sequence: GCTCCTACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2777 C. elegans pas-7(ok3447)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK945.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3447 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGTGATGATCGAGGAAGCAG. External right primer: TTCGTCTCTCCCGTAAATCG. Internal left primer: AAGCAGTTGCCGCATAACTT. Internal right primer: AACGGTTCTTCTGATTTCCG. Internal WT amplicon: 1263 bp. Deletion size: 409 bp. Deletion left flank: GAATTGTGCATAAACATGTTTCTGGTTTGT. Deletion right flank: ATTCACATCCAGCTCCTCGATCTTCAGCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807