More Fields
Strain Species Genotype
WS1609 C. elegans unc-69(ok339)/qC1 [dpy-19(e1259) glp-1(q339) III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and arrested L1 coilers. Fails to complement unc-50.
XA7400 C. elegans glc-3(ok321) V. Show Description
ZC317.3 Homozygous. Outer Left Sequence: TCAAAATACAGGGGTAGGCG. Outer Right Sequence: ACAATTCCTGGAACTCACGG. Inner Left Sequence: TGAAGAGGTTTTGAAACGCA. Inner Right Sequence: ACTTTCCGAGAGGAATGGGT. Inner Length: 2746. Estimated Deletion Size: 1200. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/
YE58 C. elegans smc-6(ok3294)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3294 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. ok3294 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.
ZT29 C. elegans cec-4(ok3124) cec-5(fj58) IV. Show Description
Maintain at 20C or lower. The cec-4 cec-5 double mutant exhibits partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-4 and CEC-5 are phylogenetically similar to CEC-8. ok3124 is a 374-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-4 (F32E10.2). The ok3124 deletion can be detected by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj58 is a 398-bp deletion located in the gene region corresponding to the N-terminus of CEC-5 (F32E10.6). The fj58 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT31 C. elegans cec-4(ok3124) cec-5(fj61) him-8(e1489) IV. Show Description
Maintain at 20C or lower. Him. cec-4 cec-5 him-8 triple mutants exhibit partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. ok3124 deletion can be detceted by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj61 is a 444-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-5 (F32E10.6). The fj61 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT34 C. elegans cec-8(fj63) III; cec-4(ok3124) cec-5(fj58) IV. Show Description
Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT35 C. elegans cec-8(fj63) III; cec-4(ok3124) cec-5(fj61) him-8(e1489) IV. Show Description
Maintain at 20C or lower. Him. The cec-8; cec-4 cec-5 him-8 quadruple mutant exhibits partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.