VC1165 |
C. elegans |
let-19&sgn-1(ok331)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F07H5.2, K08F8.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok331 homozygotes (grotty sterile Dpy with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGAAAATTGGGAGTTCGGAG. External right primer: ACCACTTGTTCCTTGCCAAC. Internal left primer: GGACTGGAAACTCCAAGCAG. Internal right primer: GACTGATGAGCCGGTATGGT. Internal WT amplicon: 2637 bp. Deletion size: 1456 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1171 |
C. elegans |
parp-2(ok344) II. Show Description
E02H1.4. 1576 bp deletion. Flanking sequences: GAGGAACCGGAACCTGAGCCGAAAGTTGAT TTAAACCTGTTAATCCAATGATACTCCTCA. External left primer: CCGCAGTACACCTTAGCCTC. External right primer: ATCCTGCTCGTCAAGCATCT. Internal left primer: GTGAAAGCCTGGAGAGCAAG. Internal right primer: ACGACACTTCAGATGGGCTT. Internal primer WT PCR product: 2610. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC125 |
C. elegans |
tyra-3(ok325) X. Show Description
M03F4.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC126 |
C. elegans |
rac-2(ok326) IV. Show Description
K03D3.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC127 |
C. elegans |
pkc-2(ok328) X. Show Description
E01H11.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC158 |
C. elegans |
lat-2(ok301) II. Show Description
B0286.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC160 |
C. elegans |
trp-1(ok323) III. Show Description
ZC21.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC161 |
C. elegans |
mtm-6(ok330) III. Show Description
F53A2.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC164 |
C. elegans |
swd-3.1 dph-1(ok329) III. Show Description
C14B1.4, C14B1.5. Slow-growing, small broods. Deletion removes 3' end of C14B1.4, 5' end of C14B1.5. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC176 |
C. elegans |
exc-7(ok370) II. Show Description
F35H8.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC177 |
C. elegans |
syx-4&ant-1.4(ok372)/mIs11 IV. Show Description
T01B11.3, T01B11.4. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] IV. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in pharynx, and segregate WT with dim GFP, WT with brighter GFP (mIs11 homozygotes), and non-GFP sterile ok372 homozygotes. Pick dim GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC186 |
C. elegans |
smo-1(ok359)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
K12C11.2. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, and homozygous ok359 hermaphrodites (sterile with one or more vulval blips). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC188 |
C. elegans |
acr-12(ok367) X. Show Description
R01E6.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC189 |
C. elegans |
pmp-4(ok396) IV. Show Description
T02D1.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC200 |
C. elegans |
rnt-1(ok351) I. Show Description
B0414.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC204 |
C. elegans |
akt-2(ok393) X. Show Description
F28H6.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC206 |
C. elegans |
fzy-1&cyp-44A1(ok312) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK177.6, ZK177.5. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- hDf35 unc-4 homozygotes (larval/sterile adult arrest). Pick fertile GFP WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC207 |
C. elegans |
atgp-1(ok388) IV. Show Description
F26D10.9. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC208 |
C. elegans |
cdd-1(ok390) X. Show Description
C47D2.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC214 |
C. elegans |
nck-1(ok383) X. Show Description
ZK470.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC222 |
C. elegans |
raga-1(ok386) II. Show Description
T24F1.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC224 |
C. elegans |
octr-1(ok371) X. Show Description
F14D12.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2245 |
C. elegans |
ZK1236.1(ok3023) III. Show Description
ZK1236.1. External left primer: TAATTGACCGTGTTCCAGCA. External right primer: TTGAGTCGTTCCATTCCTCC. Internal left primer: TATTTCGATCATTTTCGCGG. Internal right primer: CCACCAAAGTTTCCCTTCAA. Internal WT amplicon: 1179 bp. Deletion size: 508 bp. Deletion left flank: GGTTGGAGAGACACTTTTCGCTGAAACAAC. Deletion right flank: GATTCGACTCGTCTCGTGATCCTTTGGAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC225 |
C. elegans |
tps-1(ok373) X. Show Description
ZK54.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2255 |
C. elegans |
atp-2(ok3002) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C34E10.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3002 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGCCACCAAGGTTTGTAT. External right primer: CGGTAAGCTTGTCTTCCTCG. Internal left primer: AGGTCTCTGCCAAGGCTACA. Internal right primer: TTTGAACTCCACGAGCAATG. Internal WT amplicon: 1178 bp. Deletion size: 500 bp. Deletion left flank: CAAGGCTACAGCTGCTAACGCTTCCGGACG. Deletion right flank: GTTACTCTGTGTTCGCTGGAGTCGGAGAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2262 |
C. elegans |
nas-9(ok3019) V. Show Description
C37H5.9. External left primer: GAAACCGTACATCCCCACAC. External right primer: GCCGGAAATGTATAGACGGA. Internal left primer: GCTCAAGTAAATCGGGTTGG. Internal right primer: GGACCATTCATAGGATGCAAA. Internal WT amplicon: 1236 bp. Deletion size: 666 bp. Deletion left flank: GCATTGTACCTGAATAGGATGCAGGTGTTG. Deletion right flank: TTTGTCAATAGCTCCTGCTTTGCCTGTGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2263 |
C. elegans |
Y47D3B.6(ok3027) III. Show Description
Y47D3B.6. External left primer: CCTCCAAACAAGGCAACATT. External right primer: TGATTTTTCTTGAAAGCCCG. Internal left primer: CCATTGCGATTCACACTCAG. Internal right primer: TTGGGTTTTGTTTTGGGG. Internal WT amplicon: 1120 bp. Deletion size: 558 bp. Deletion left flank: GATGATGGCTCCACCAGCACCACTCCCAGC. Deletion right flank: AGTCTGCCAGTGCGCCGGAGCCTACGAGCC. Insertion Sequence: CTCCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2264 |
C. elegans |
ztf-16(ok3028) X. Show Description
R08E3.4. External left primer: TGGCATCAACAAAGAAATGG. External right primer: AGCTGCGTCTCTGATTGGTT. Internal left primer: CTCTGTTGACGATGCTCACAA. Internal right primer: ATGAAAGACAAAGGTTGCGG. Internal WT amplicon: 1292 bp. Deletion size: 571 bp. Deletion left flank: TGACTCATTGGCTGGCGGCGAGTGCGACTG. Deletion right flank: ATATCACATGATGAGAGAGATTCCACGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2273 |
C. elegans |
Y105E8B.9(ok3031) I. Show Description
Y105E8B.9. External left primer: TCTTGAGTTGTTCGTGGCTG. External right primer: CCACACAGTACCCTCACTGC. Internal left primer: GGCATGAATTCTCCATCGTC. Internal right primer: TCCCTTTTTAGTTTTACCTACCGA. Internal WT amplicon: 1214 bp. Deletion size: 737 bp. Deletion left flank: CAACTATAAAACACAACACCAAATGTTGAG. Deletion right flank: TACCTCAAATTAAGTAATTTATTTTTCGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2297 |
C. elegans |
unc-122(ok3029) I. Show Description
F11C3.2. External left primer: CCCATTCACATTTTCAGGCT. External right primer: TGCCGCACACCAATAATAAA. Internal left primer: CCGGCGAAATAGGAAATGTA. Internal right primer: ACTTCCTGCGGAAGAAACCT. Internal WT amplicon: 1145 bp. Deletion size: 741 bp. Deletion left flank: AAGATACTATCATTCCAGTGAGTATAAAAC. Deletion right flank: TTTGTTCGCGGAATTTTGAGGCTGGAAACT. Insertion Sequence: TATTTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC230 |
C. elegans |
vap-1(ok392) X. Show Description
F11C7.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2309 |
C. elegans |
ZK669.4(ok3001) II. Show Description
ZK669.4. Strain might be sensitive to hypochlorite; no survivors after mutliple attempts to clean by hypochlorite treatment. External left primer: TAGAGTGTTGAAAACGGGGG. External right primer: CCACACCAGCAGTTCGTAGA. Internal left primer: CATCAAGGGATAATTGGGCA. Internal right primer: GGAACTGGAAAAGACGGAAG. Internal WT amplicon: 1181 bp. Deletion size: 401 bp. Deletion left flank: TGTCATGTTTATCGAATCGTGGGAGTTTTT. Deletion right flank: CATTTTCCATTTTCTCATCAGTTGTAGAAT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2310 |
C. elegans |
Y97E10AR.2(ok3098) V. Show Description
Y97E10AR.2. External left primer: TTGCCGTTCACAGTATCCAA. External right primer: ACGTCGAACTGATCCCCATA. Internal left primer: GAAACTGGTGGAAACGCTGT. Internal right primer: GAACGCTTACGAATAGAAGAGCA. Internal WT amplicon: 1332 bp. Deletion size: 716 bp. Deletion left flank: CATCCGCACACTACAGGACCGGGTTTTGGA. Deletion right flank: ATCATTTCCATCAAACCCAGAATATATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2311 |
C. elegans |
inx-15(ok2377) bli-4(ok3478) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R12E2.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Deletion chromosome appears to carry a second-site mutation in bli-4. Heterozygotes are Bli with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2377 homozygotes (early larval arrest, Dpy). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick Bli GFP and check for correct segregation of progeny to maintain. External left primer: AACAAGCCACACCGATAAGG. External right primer: GCAGACAAAAGGACCTGCAT. Internal left primer: TCGATGTTCGGAATACGATG. Internal right primer: TTTTAGATTATTTCAAAAGCGCA. Internal WT amplicon: 3163 bp. Deletion size: 1297 bp. Deletion left flank: CGAAGCATGGAAGAAATGTTGGAAAGACGT. Deletion right flank: AAGTCATATATTGTTTGATATCAATTATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2312 |
C. elegans |
let-363(ok3018) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0261.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3018 homozygotes (late larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCCGCTCCAGCTACAAAT. External right primer: ATCGAGCTTTGCTGTTTCGT. Internal left primer: AGGGATTGATGCTGCAAGAG. Internal right primer: TTCGGAAATCGTTCCAAAAC. Internal WT amplicon: 1186 bp. Deletion size: 664 bp. Deletion left flank: GAGCCGGTATCTATCTCATCGTGTGCTTAG. Deletion right flank: ATTCGAACTCATCAGATGTGAATCCTCACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2321 |
C. elegans |
gcy-18(ok3047) IV/nT1 [qIs51] (IV;V). Show Description
ZK896.8. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3047 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATCGCTAATCCACTGGAACG. External right primer: CGATCCTCCAACCAGAATGT. Internal left primer: CTGCAAAAGATTCGGACGAT. Internal right primer: GTGCCCTTTCCTTTCACTTG. Internal WT amplicon: 1263 bp. Deletion size: 517 bp. Deletion left flank: TTTCAGCAATAATCTATATGGCTCCTGAAC. Deletion right flank: GAATGTTAGAAGAAGCCAACATCCGTGCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2322 |
C. elegans |
Y106G6E.4(ok3105) I. Show Description
Y106G6E.4. External left primer: CACCTCGGAAGGCTAGAATG. External right primer: CCGATCCCTGACGATATCAA. Internal left primer: TCACAAAACCATTTGAGGAATG. Internal right primer: GGCAAAACATTTCCATGTGC. Internal WT amplicon: 1245 bp. Deletion size: 369 bp. Deletion left flank: TACAGCCTTCATGTCTAGGGGCCTACTTTA. Deletion right flank: TTCATAAACTGCCTGAGCTCTGATTTTACC. Insertion Sequence: TTCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2324 |
C. elegans |
flp-6(ok3056) V. Show Description
F07D3.2. External left primer: ACTCCCCCTCATCCAAATTC. External right primer: TTTCGCGAATGAAGCTATGA. Internal left primer: CCCCACGTTACCAGATGATATT. Internal right primer: CCAGTTGGTCCTTACAAGAGC. Internal WT amplicon: 1129 bp. Deletion size: 421 bp. Deletion left flank: TATGTTTTTCTGTTCAACGTTTTTTATTTA. Deletion right flank: GTGGAAACCCAATGGAAATGGAAAAACGGA. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2325 |
C. elegans |
C50F4.6(ok3072) V. Show Description
C50F4.6. External left primer: GATGATGACGAAGAGCAGCA. External right primer: ACAATTCCAGGTGGACAAGC. Internal left primer: CGGAGCAGAATAAGGAGCAG. Internal right primer: CAGCTAGCGAGGCAAAATCT. Internal WT amplicon: 1145 bp. Deletion size: 355 bp. Deletion left flank: GCAGCAGCAGTCATCCAGTTCGAAGAGTAC. Deletion right flank: AACTCATTCGCTTTCGTTTTCTAACAACTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC233 |
C. elegans |
gpn-1(ok377) X. Show Description
F59D12.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2330 |
C. elegans |
Y39A1C.1(ok3032) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y39A1C.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3032 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCGTGGTGACTCCAAAACTT. External right primer: CTGCGTCTCCTCCTCTTCAC. Internal left primer: TTGGGTTTCCATGGTGACTT. Internal right primer: AAAAACCCGCATCTAACCAC. Internal WT amplicon: 1253 bp. Deletion size: 520 bp. Deletion left flank: CGAACCGTGGTGTCTCCAGGCGGGAATTCA. Deletion right flank: TTTTTGTAAATAAATTGAATTTTTAATATG. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2334 |
C. elegans |
K11D2.5(ok3030)/hIn1 [unc-101(sy241)] I. Show Description
K11D2.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3030 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTTGGCAAATTTTTGATGGC. External right primer: ATTTTCCGCTCGGAATTTTT. Internal left primer: TCTTTCGTGCTTCCAGCTTC. Internal right primer: TTTCTCGTTGATTTTCCCCA. Internal WT amplicon: 1208 bp. Deletion size: 605 bp. Deletion left flank: ATTGGTGGATTTTTCTCCAGAAAGCAGGTG. Deletion right flank: TTCAAAATTTTAGGTCTTGAAATTTCTAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2337 |
C. elegans |
Y116A8C.4(ok3077) IV. Show Description
Y116A8C.4. External left primer: CGACGTTGTTTCCAGGATTT. External right primer: TTCCACCCAACTCACATTCA. Internal left primer: GCGCTGAGCTCTCAAAGACT. Internal right primer: GACAAGCCCCATAAAGTCCA. Internal WT amplicon: 1215 bp. Deletion size: 526 bp. Deletion left flank: TGTATCACGCTTGCTCATCAATTGGTAGGA. Deletion right flank: TTTCTTCAAATAGTTATTTTAGAAATGCTC. Insertion Sequence: TCGACATCTTCCGGGTTTCCAGACCCATAAAATGTCGGTTGCTAGATAATAAATCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2338 |
C. elegans |
pgp-3(ok3091) X. Show Description
ZK455.7. External left primer: GCGAATGCTCTTATGGAAGG. External right primer: TTGCAAATGAACTCGTGAGC. Internal left primer: CGTTATGCGAACGACGACTA. Internal right primer: ATTCGGATGTTTTCAGCGAC. Internal WT amplicon: 1151 bp. Deletion size: 609 bp. Deletion left flank: TTCGATGTATCTATCAGCGAAGCATCTGAA. Deletion right flank: GCTTGTTGGGCATTCTGGATGTGGAAAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2345 |
C. elegans |
clec-106&Y18D10A.23(ok3090) I. Show Description
Y18D10A.12, Y18D10A.23. External left primer: ACCACGACTGGGAAGTTCAG. External right primer: GCCTAACATCTGCCTTCTCG. Internal left primer: ACTGGATTCTAGGCCCACG. Internal right primer: GTTGCTCCATGCTACGTGAA. Internal WT amplicon: 1318 bp. Deletion size: 724 bp. Deletion left flank: CCTCCGTTTTGGTTTATGATATCGCGGAAG. Deletion right flank: TGCTCTTGAACCCGTCTCTGAACCAATTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2346 |
C. elegans |
hsp-12.3(ok3095) IV. Show Description
F38E11.1. External left primer: TAAATCGGCAGAAAACGACC. External right primer: TGTTGCTCTCGAATCGTCAC. Internal left primer: AAAATTGTGGCCACCAAAAA. Internal right primer: ATTTCGTTGCTCATTGGTCC. Internal WT amplicon: 1297 bp. Deletion size: 533 bp. Deletion left flank: TGTTCACCATAAGAAACGAGGCGTCTCCTC. Deletion right flank: AAGGAATTCTCCAATGTTCTTCACATCAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2347 |
C. elegans |
Y48G8AL.13(ok3097) I. Show Description
Y48G8AL.13. External left primer: GTCGTTCGTGACCGAAAAAT. External right primer: ATGGCAGAAACTGGCAAAAG. Internal left primer: AGGCTCTCCCATTACGGTTT. Internal right primer: TTTTGTGTTCTTTCTTGGAGC. Internal WT amplicon: 1097 bp. Deletion size: 739 bp. Deletion left flank: CGTCTCTCAACTCCCGCATTTTTTGTAGAT. Deletion right flank: GATGACGAGCGAATGATGAATGAGATATTC. Insertion Sequence: GACGAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2348 |
C. elegans |
T05C12.1(ok3101) II. Show Description
T05C12.1. External left primer: TTCCCGAGTATAGTCCCGTG. External right primer: CATGTGGATTGATTGTCCCA. Internal left primer: CAAGCAAAACGGTCATCAGA. Internal right primer: TGCTCATCTTGTTTCTTTCATTTT. Internal WT amplicon: 1144 bp. Deletion size: 531 bp. Deletion left flank: GATGCAAATGCTTGGAAAGAATATTGGAGA. Deletion right flank: TTCGTCCAGCCAACACTCCGGATTATACCA. Insertion Sequence: GAAATAGGAAAGAATATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2349 |
C. elegans |
cpg-7(ok3141) II. Show Description
K09E4.6. External left primer: GAAAAATCTACACCGGCCAA. External right primer: CACCCTGCCTTCTTCACATT. Internal left primer: ATCGGGAGGACTCGAAAAGT. Internal right primer: CAGCTTTTGTCTCAGGCGAT. Internal WT amplicon: 1242 bp. Deletion size: 383 bp. Deletion left flank: AGATGATTCAAGGGTTGCATCACCGGATCC. Deletion right flank: ATATAGGCATATAGGCATATAGGCATATAGGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2352 |
C. elegans |
R07C12.1(ok3048) IV/nT1 [qIs51] (IV;V). Show Description
R07C12.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3048 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATTTGGAGGCCAGTGTTGT. External right primer: GCCCTGAAACCGAAGTGTAA. Internal left primer: GCTCTGTTTGTAGGCTTGGG. Internal right primer: CAGCATATGGTGGCCAGTAG. Internal WT amplicon: 1301 bp. Deletion size: 537 bp. Deletion left flank: AATTGGTAGTGACTCGTTGAAAATTGTTGA. Deletion right flank: TGGTATACGTTTCTTTAAATTTTTTTTAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|