More Fields
Strain Species Genotype
PE867 C. elegans pink-1(ok3538) II; feIs4 V. Show Description
feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V. Rollers. Strain expresses firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C) in the pink-1(ok3538) mutant background. It is rendered bioluminescent when it ingests D-luciferin. References: Lagido, C, et. al. (to be submitted to bioRxiv). Novel HTS platform for the identification of drugs active in the modulation of mitochondrial function in age-related diseases.
PE868 C. elegans pink-1(ok3538) II; feIs5 X. Show Description
feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. Rollers. Strain expresses firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C) in the pink-1(ok3538) mutant background. It is rendered bioluminescent when it ingests D-luciferin. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido, C, et. al. (to be submitted to bioRxiv). Novel HTS platform for the identification of drugs active in the modulation of mitochondrial function in age-related diseases.
PHX293 C. elegans nas-38(syb293) X. Show Description
Increased lethargus duration and increased movement quiescence during lethargus. syb293 is a clean C-terminal deletion starting from the same position where nas-38(ok3407) is truncated, removes a large part of the TSP domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
RB1399 C. elegans T01H8.2(ok340) I. Show Description
T01H8.2. Superficially wild type. NOTE: It has been reported that this strain has a low brood size and is prone to going sterile. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1400 C. elegans tre-3(ok394) V. Show Description
W05E10.4 Homozygous. Outer Left Sequence: ccttatcttgcatttcggga. Outer Right Sequence: cttcttcttttgcggtttcg. Inner Left Sequence: gactccatccatttgggaaa. Inner Right Sequence: cattcctagaacctccctgg. Inner Primer PCR Length: 2813. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1402 C. elegans far-4(ok317) V. Show Description
F15B9.2 Homozygous. Outer Left Sequence: acggagaagaaccaagcaga. Outer Right Sequence: ttcaaacgtgtgatgaggga. Inner Left Sequence: ggcggttcaattcttccata. Inner Right Sequence: agagtggtggcattacctcg. Inner Primer PCR Length: 3041. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1451 C. elegans rsp-5(ok324) II. Show Description
T28D9.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2218 C. elegans jac-1(ok3000) IV. Show Description
Y105C5B.21. Homozygous. Outer Left Sequence: ACATCTCACGGGTTCCACTC. Outer Right Sequence: TCGTAAGATTCAGCGCAATG. Inner Left Sequence: AAGTTCCCGATTCCTTGGAT. Inner Right Sequence: GCGTTCTACCAAAGCTACCG. Inner Primer PCR Length: 1249 bp. Deletion Size: 456 bp. Deletion left flank: CTCAAGGATCACAGGCTTCAACATATCCGC. Deletion right flank: AAACAAAGTTTTGAGCTTTTAACGTAAGTT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2219 C. elegans C28C12.9(ok3004) IV. Show Description
C28C12.9 Homozygous. Outer Left Sequence: tcgtcgatcaatcctgacaa. Outer Right Sequence: cgttaatacttcgtggccgt. Inner Left Sequence: caacgaagactctagggcgt. Inner Right Sequence: cccggccatattatttttga. Inner Primer PCR Length: 1333. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2220 C. elegans R13H9.5(ok3005) IV. Show Description
R13H9.5 Homozygous. Outer Left Sequence: aatgaactcaaaacgggacg. Outer Right Sequence: tgtaatgacgcttgtcggaa. Inner Left Sequence: cggttccagtccagtctgat. Inner Right Sequence: agtctttgcaggtaaatacgagtt. Inner Primer PCR Length: 1218. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2221 C. elegans Y113G7B.14(ok3006) V. Show Description
Y113G7B.14 Homozygous. Outer Left Sequence: ggacccctgacatgaacttg. Outer Right Sequence: gtctcgaaagtcgtcttggc. Inner Left Sequence: tgtccgacaatgagaatgga. Inner Right Sequence: tttcatcatcggaacaagca. Inner Primer PCR Length: 1147. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2222 C. elegans fkb-2(ok3007) I. Show Description
Y18D10A.19 Homozygous. Outer Left Sequence: agtcgaagctcacgattgct. Outer Right Sequence: cggagatttcgacttcaagg. Inner Left Sequence: ccgtagccaggagaaaaatg. Inner Right Sequence: ttatggagaggttgcacacg. Inner Primer PCR Length: 1148. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2223 C. elegans grd-10(ok3008) IV. Show Description
F09D12.1 Homozygous. Outer Left Sequence: tcgtcatctttttgtcgctg. Outer Right Sequence: attgaaccaatagttgcggg. Inner Left Sequence: ttcttgtgttccaaaagggc. Inner Right Sequence: ttgagatagggtaaaagaagatcg. Inner Primer PCR Length: 1202. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2224 C. elegans F38B6.6(ok3009) X. Show Description
F38B6.6 Homozygous. Outer Left Sequence: aaacgtgtaccgagattcgc. Outer Right Sequence: tggtgaatggatttgaagca. Inner Left Sequence: aacaaaactgaagttggattcagaaacaaaactgaagttggattcaga. Inner Right Sequence: gggatgcatttcctccatta. Inner Primer PCR Length: 1214. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2225 C. elegans col-179(ok3010) X. Show Description
C34F6.3 Homozygous. Outer Left Sequence: cctgccactaaagagaacgc. Outer Right Sequence: gcggaaacaaggattatgga. Inner Left Sequence: ggttgcaaagtgattgcaga. Inner Right Sequence: tggtaagaaacgttcacgca. Inner Primer PCR Length: 1291. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2226 C. elegans ZC416.2(ok3011) IV. Show Description
ZC416.2 Homozygous. Outer Left Sequence: ctggggtcaaaagtcggtta. Outer Right Sequence: gttaaaattgtctgccgcgt. Inner Left Sequence: tcccaaactccaatttccag. Inner Right Sequence: gcatcggggtgactcttact. Inner Primer PCR Length: 1235. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2227 C. elegans K06H6.3(ok3012) V. Show Description
K06H6.3 Homozygous. Outer Left Sequence: gcaaatactgaacccgcaat. Outer Right Sequence: ccgacgaatttttcagcatt. Inner Left Sequence: ttttatttcggattgccagg. Inner Right Sequence: ttttcaaagtagacgccttcaa. Inner Primer PCR Length: 1395. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2228 C. elegans klp-20(ok3013) III. Show Description
Y50D7A.6 Homozygous. Outer Left Sequence: atcacaacgggaatctggag. Outer Right Sequence: ttcaacggcaaaaatgttca. Inner Left Sequence: gaatttggaatcctcccgat. Inner Right Sequence: tcatatttctcacctcaatttctca. Inner Primer PCR Length: 1132. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2229 C. elegans cyn-7(ok3014) V. Show Description
Y75B12B.2 Homozygous. Outer Left Sequence: acttccggattgttgacctg. Outer Right Sequence: agctcatccgtgtgcttctt. Inner Left Sequence: gtgaagagctggcaacaatg. Inner Right Sequence: tgattcccgctctattaccg. Inner Primer PCR Length: 1175. Deletion size: about 600 bp. cyn-7 was formerly known as cyp-7. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2230 C. elegans ZC395.10(ok3015) III. Show Description
ZC395.10 Homozygous. Outer Left Sequence: cttgcccatggaaactgatt. Outer Right Sequence: caatgccattcgcacttaaa. Inner Left Sequence: gaaaaacgaatgcgggataa. Inner Right Sequence: tcttgcttgttattgccgtg. Inner Primer PCR Length: 1195. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2231 C. elegans F47A4.1(ok3016) X. Show Description
F47A4.1 Homozygous. Outer Left Sequence: gcccgaagaagattaccaaa. Outer Right Sequence: acgacccaacgaacagaaac. Inner Left Sequence: tcctttcattcttttgctcaca. Inner Right Sequence: aagcggaaagtgtttctcctc. Inner Primer PCR Length: 1179. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2232 C. elegans grl-17(ok3017) V. Show Description
C56A3.1 Homozygous. Outer Left Sequence: tgattggcacatagtcggaa. Outer Right Sequence: ctacgttcaaagcggaggag. Inner Left Sequence: aaatgacagattgaagcggg. Inner Right Sequence: gaaaaacatggcaaccttcc. Inner Primer PCR Length: 1162. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2233 C. elegans Y50D7A.10(ok3020) III. Show Description
Y50D7A.10. Homozygous. Outer Left Sequence: CCGCCCCTTTAATAGAAACC. Outer Right Sequence: GTACGAGGAGTCCGCACATT. Inner Left Sequence: TTTGTTTTCCGCCTGTTTTC. Inner Right Sequence: ATATTTGCCAAGAAAGGGGC. Inner Primer PCR Length: 1152 bp. Deletion Size: 741 bp. Deletion left flank: TTTTTTTGCGAAAATCTCGGCTTTTTCACC. Deletion right flank: TGTAGAGCTAAACTTAAACGAAAAATGGTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2234 C. elegans E04A4.6(ok3021) IV. Show Description
E04A4.6. Homozygous. Outer Left Sequence: GAGACATGCGTCAGCAAAGA. Outer Right Sequence: GCAATTTCAGCATCCGATTT. Inner Left Sequence: GCTTGCGTCCTTCTTGACTT. Inner Right Sequence: TGGAACTCAAAATGTGATAACGA. Inner Primer PCR Length: 1379 bp. Deletion Size: 515 bp. Deletion left flank: AAGGAAGAACACAGGAGATGGTGCAATAGA. Deletion right flank: CTGTCATATTCCTTTTCGTTATCACATTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2235 C. elegans cyp-35B1(ok3022) V. Show Description
K07C6.4. Homozygous. Outer Left Sequence: AATTCTCTGCTCGTCGGAAA. Outer Right Sequence: TCAATATGCACACAGCGACA. Inner Left Sequence: TCGAGGCCGAAGATAAGGAT. Inner Right Sequence: GCTTTTTAGGCTTTCTCGTGG. Inner Primer PCR Length: 1144 bp. Deletion Size: 480 bp. Deletion left flank: ATCTCTGGTTAGCTGGTCAAGATACCACTT. Deletion right flank: TTGGAAATCTTATCCTGCGATATGACATTA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2237 C. elegans tub-2(ok3024) I. Show Description
Y71G12A.3. Homozygous. Outer Left Sequence: AGGCGACTTCTCTCCCTCTC. Outer Right Sequence: TCATCATTATCGCCGATTCA. Inner Left Sequence: GTGTGTGTGTGTGTGTGCGT. Inner Right Sequence: TCCTTTCCACCAACGGATTA. Inner Primer PCR Length: 1267 bp. Deletion Size: 522 bp. Deletion left flank: GGTGTTAGGCTTTTCCACTGGAACTATTCA. Deletion right flank: TAAGCTGCCGATTCCACTCAAGGAGATGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2238 C. elegans C25F6.6(ok3025) X. Show Description
C25F6.6. Homozygous. Outer Left Sequence: AAAGACGATGGAGGCAAATG. Outer Right Sequence: CCCCTAGGTGGCTTGACTTT. Inner Left Sequence: CAACATCTTCACCGTCACCA. Inner Right Sequence: CAACGTCACAATTCACTTGC. Inner Primer PCR Length: 1278 bp. Deletion Size: 637 bp. Deletion left flank: ATGCGGGACTCAAACTTCTGAGTGAAAAGT. Deletion right flank: AAAAAAATAGAATGTTACTAAGGACAAGGA. Insertion Sequence: ATAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2239 C. elegans W03G1.5(ok3026) IV. Show Description
W03G1.5. Homozygous. Outer Left Sequence: TCGAGATGTCTTCGCCTTTT. Outer Right Sequence: GTGGTGAAGCTGTACGCTGA. Inner Left Sequence: GGAGTCTGGTGGAAATTGGA. Inner Right Sequence: GGTGAGAAGGATCTGAAGGG. Inner Primer PCR Length: 1356 bp. Deletion Size: 612 bp. Deletion left flank: TCCATGGCGTCCTGGACAATGTGGTGGGCC. Deletion right flank: TCATTTTCGTCATCGCTGCTTTCCGATCCT. Insertion Sequence: TCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2240 C. elegans sams-1(ok3033) X. Show Description
C49F5.1. Homozygous. Outer Left Sequence: AGGACTTGCGAGAGTACGGA. Outer Right Sequence: CTTGAGAGCTTTTGGCTGCT. Inner Left Sequence: AGTGAATCTGTGTCCGAGGG. Inner Right Sequence: GGGAACTCAGAGTGACCGAA. Inner Primer PCR Length: 1248 bp. Deletion Size: 480 bp. Deletion left flank: ACTCCGCGTTCACACTGTTGTGGTCTCTAC. Deletion right flank: TAGATAGGAGAAATTTCATTGGTTTTTTAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2241 C. elegans Y116A8C.5(ok3034) IV. Show Description
Y116A8C.5. Homozygous. Outer Left Sequence: ACGAATGTTGATCGGTGACA. Outer Right Sequence: AAATGTGGCTCTTTTGCAGC. Inner Left Sequence: GCTGCCAGGATTTATGCTTC. Inner Right Sequence: GCCGACACTTTTTGGGTTT. Inner Primer PCR Length: 1161 bp. Deletion Size: 672 bp. Deletion left flank: GGTAAGTTCCTAGCACTCTGGTTTCCAACT. Deletion right flank: TCTAGACGATTTGGCAGAGTATGTTAATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2242 C. elegans bbs-2(ok3035) IV. Show Description
F20D12.3 Homozygous. Outer Left Sequence: gaatcggatcaaggacctca. Outer Right Sequence: tatgtggatcaacgttgcca. Inner Left Sequence: tggatgataatgtcgaacttgc. Inner Right Sequence: tttacacatctcaaaaatcagtgaa. Inner Primer PCR Length: 1215. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2243 C. elegans lact-4(ok3036) II. Show Description
M05D6.4. Homozygous. Outer Left Sequence: ACTGTTGGGCCATACTCGAC. Outer Right Sequence: AGCAAAAATGCGCTTCATCT. Inner Left Sequence: CAATTGGAGAGAAGCCGAAG. Inner Right Sequence: AAAACAATGGCAAGATATAAACTGT. Inner Primer PCR Length: 1228 bp. Deletion Size: 539 bp. Deletion left flank: ATTGTGTTCAAATTCTTTAAGCATAAAACC. Deletion right flank: ATGCTCAATTGAAAACATTAAGTTTTTATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2244 C. elegans grl-9(ok3038) V. Show Description
ZC487.4. Homozygous. Outer Left Sequence: CGATGTGATTTATTGCACGG. Outer Right Sequence: CTCTCCTGGCTTTTACGCAG. Inner Left Sequence: GTGAATGGAGGAAAGCGAAG. Inner Right Sequence: CCGAATGGACAAGTTGGAAG. Inner Primer PCR Length: 1291 bp. Deletion Size: 253 bp. Deletion left flank: GTGGAAGTTGAACCTGTTGCTGTTGCAGTT. Deletion right flank: AATTTTAGGCGAGTGAACACACAAAAGTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2245 C. elegans C47D12.8(ok3039) II. Show Description
C47D12.8 Homozygous. Outer Left Sequence: ctcaacgccttccaagactc. Outer Right Sequence: caggatcccataaaggctca. Inner Left Sequence: tttgtaccgcgaaaagaagc. Inner Right Sequence: tgaaaatggcgagaaaaacc. Inner Primer PCR Length: 1181. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2246 C. elegans T11F1.9(ok3040) II. Show Description
T11F1.9. Homozygous. Outer Left Sequence: ATTCCCGCTGTGATGAAAAG. Outer Right Sequence: CCGCAGATTTCAACAAGGAT. Inner Left Sequence: GAAGATGATGTACTCACTCCCAA. Inner Right Sequence: TGAAAGAACTCAAAGCGCAA. Inner Primer PCR Length: 1360 bp. Deletion Size: 675 bp. Deletion left flank: TATGAAATGATAAGGAGACTTACGGCAATC. Deletion right flank: TTCCAAGTTTTCCCCAAAATGATTCGAATG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2247 C. elegans eat-17(ok3041) X. Show Description
T24D11.1. Homozygous. Outer Left Sequence: GGATTGAAGTGGCTTTCCAA. Outer Right Sequence: AGAGTCAAATGCCGAAAAGC. Inner Left Sequence: TTTTCAGGCAAAATGCAGC. Inner Right Sequence: AGGCTCAAGTAGGCTCAAGTG. Inner Primer PCR Length: 1237 bp. Deletion Size: 856 bp. Deletion left flank: AGATTGAGAGAAAATGGGAATGGATCGGAG. Deletion right flank: TGATAACGTTGAACAGAAGTGATTGGCCTC. Insertion Sequence: TGGGAATGGATCGGAGTGGATCGGAAATGGAATGGATCGGAAATGGGAATGGATCGGAG . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2248 C. elegans gst-24(ok3042) II. Show Description
F37B1.1. Homozygous. Outer Left Sequence: GCGACGATTCATGGTCTTTT. Outer Right Sequence: CTCTCCCTCCCCTCAATTTC. Inner Left Sequence: CAAACTCCCCAGGTGTGACT. Inner Right Sequence: GGAGATTTTCGAAACGACTTTG. Inner Primer PCR Length: 1157 bp. Deletion Size: 555 bp. Deletion left flank: TCATTAACCTTCTCACGGAGCGCTGCAAGC. Deletion right flank: AGTTATACAAATACCACTAAAAATGTTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2249 C. elegans F32H2.6(ok3043) I. Show Description
F32H2.6. Homozygous. Outer Left Sequence: GGAAGACGAGCTTCCAGATG. Outer Right Sequence: TCTCGACGGTTTCCGTTATC. Inner Left Sequence: GAGGAAGAAGCTCAGGGTCC. Inner Right Sequence: CATCTGTGCCGTGCAGTAAT. Inner Primer PCR Length: 1288 bp. Deletion Size: 380 bp. Deletion left flank: ATGCCACCGAACATTTTGACTTCTTTATTA. Deletion right flank: GACGACTATCCTTTGTGGCAAAAGAAGAGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2250 C. elegans puf-6(ok3044) II. Show Description
F18A11.1. Homozygous. Outer Left Sequence: GCGAAATTTCACGTTTTTCC. Outer Right Sequence: AAAATCCGCAGCAATGAAAG. Inner Left Sequence: AATACGGTACCCGGGGTCT. Inner Right Sequence: TTGGTCTTTTTAGGCCTTGC. Inner Primer PCR Length: 1113 bp. Deletion Size: 722 bp. Deletion left flank: TTTAAAGGCGCACTTTTTTCGAATTTAACC. Deletion right flank: GAGAGGAAATGCACGAAAAAGGTCCACATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2251 C. elegans cpg-8(ok3045) V. Show Description
K03B4.7. Homozygous. Outer Left Sequence: TCGAGGATCTCAAGGATTGG. Outer Right Sequence: CCAAATAGACCCGCAACATT. Inner Left Sequence: CTCGACTCGTTGACGACCTT. Inner Right Sequence: TTTGATCTACTCTTTTAGCCAGTTT. Inner Primer PCR Length: 1258 bp. Deletion Size: 979 bp. Deletion left flank: TGCTTTGAGCAAAAAAAATTGAAAGAACGT. Deletion right flank: GTGCGGGGAGAGTGACCAGAAACTGATGAG. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2252 C. elegans nas-3(ok3046) V. Show Description
K06A4.1. Homozygous. Outer Left Sequence: CTTAAAGGTCGAAGCATGGC. Outer Right Sequence: TGTTGAAGCACAAAGATCGG. Inner Left Sequence: TTCACCCACTCCAACTTCTAA. Inner Right Sequence: CGGCGCTTTCTGAAATAAAA. Inner Primer PCR Length: 1162 bp. Deletion Size: 377 bp. Deletion left flank: CTCCGAACCACCAAAGGATGACGATATCGC. Deletion right flank: TGGCTCTTCGGAACTCGTGATGGAAAAGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2253 C. elegans ZK896.9(ok3050) IV. Show Description
ZK896.9. Homozygous. Outer Left Sequence: GGCTCACAAAAGCAGAAACC. Outer Right Sequence: TGCCCATTTTCCACTTTTTC. Inner Left Sequence: TCAAATACTCATCACTGGTGGTTC. Inner Right Sequence: ACGGTCACTCGTCCATTTTC. Inner Primer PCR Length: 1146 bp. Deletion Size: 590 bp. Deletion left flank: TTGCCAAGTGAGATTATTAGCTTAAAATCC. Deletion right flank: ATCACGAATTCTTCGTCAACTGGAGGGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2254 C. elegans scrm-8(ok3051) IV. Show Description
K08D10.7. Homozygous. Outer Left Sequence: GCAATTAGCTTAACGTCCGC. Outer Right Sequence: GTTTGCAAGTGAAATGGGCT. Inner Left Sequence: GTCACCTGAGGAGGTTGAGC. Inner Right Sequence: ACATCTCCTGCATGAATCCC. Inner Primer PCR Length: 1122 bp. Deletion Size: 407 bp. Deletion left flank: GACTGTAAGTCATTCTAGCTAATGGTGACC. Deletion right flank: CAGTAATAACTACAGTACTACATTAAACTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2255 C. elegans ZC395.10(ok3052) III. Show Description
ZC395.10. Homozygous. Outer Left Sequence: CTTGCCCATGGAAACTGATT. Outer Right Sequence: CAATGCCATTCGCACTTAAA. Inner Left Sequence: GAAAAACGAATGCGGGATAA. Inner Right Sequence: TCTTGCTTGTTATTGCCGTG. Inner Primer PCR Length: 1196 bp. Deletion Size: 816 bp. Deletion left flank: AAGAATTAAATTAGAGAAATTCAAATTGTA. Deletion right flank: ATTCGAAAAGAGAACTAGACGGATACGAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2256 C. elegans F55A4.1(ok3053) X. Show Description
F55A4.1. Homozygous. Outer Left Sequence: GCATTGGGACAGAGGAGGTA. Outer Right Sequence: TGCACTGACCAAAAGGAATG. Inner Left Sequence: ATGCACATCCCACAACACAT. Inner Right Sequence: GTGGCGACTGGCTTAAAAAT. Inner Primer PCR Length: 1221 bp. Deletion Size: 736 bp. Deletion left flank: TCCTTTCAATGCGTATTTCACCATCGTTTT. Deletion right flank: AAACACGCAATGAATACGGTATCCAATGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2257 C. elegans apd-3(ok3058) II. Show Description
W09G10.4. Homozygous. Outer Left Sequence: CGGAAAATCGAAAAATGTCC. Outer Right Sequence: AAATCACCAATTTTCGCCAC. Inner Left Sequence: TCTCAATCTCCTGTTCCCTCA. Inner Right Sequence: ATTTTCCCCCAATTTTCCAG. Inner Primer PCR Length: 1120 bp. Deletion Size: 457 bp. Deletion left flank: GCTTTGAGCATTGATTCGAGCACACCTTGT. Deletion right flank: ACGGTTACATCTTGGATCTGGAAAATTGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2258 C. elegans F17A2.3(ok3059) X. Show Description
F17A2.3. Homozygous. Outer Left Sequence: CGGGGCCTAAATATGAGGTT. Outer Right Sequence: ACCAGTGAAGGATTTGTGGC. Inner Left Sequence: GTACACGCCACGCAGTTTTA. Inner Right Sequence: GAACAACGTGAAAGTGGCAA. Inner Primer PCR Length: 1321 bp. Deletion Size: 578 bp. Deletion left flank: AAGCAAACAAACACGGTTGGAATAGGATCC. Deletion right flank: CACTAACGACAGCCTCGACACCACAGCATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2259 C. elegans srh-16(ok3060) V. Show Description
F55C5.9 Homozygous. Outer Left Sequence: gcaggaaatgcattgtcaaa. Outer Right Sequence: cttcaagatgagccccaaaa. Inner Left Sequence: tctgattgtgataatcgccc. Inner Right Sequence: tccgtgaacgaatgtctgaa. Inner Primer PCR Length: 1173. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2260 C. elegans alfa-1(ok3062) II. Show Description
F18A1.6. Homozygous. Outer Left Sequence: GTCGAGACCGAACACCGTAT. Outer Right Sequence: CCACATACGATGCGCTTAAA. Inner Left Sequence: GGCAATATTTTGTGCCTGGT. Inner Right Sequence: TGCCGCTGTTAAAAGACTGA. Inner Primer PCR Length: 1259 bp. Deletion Size: 486 bp. Deletion left flank: GTCATCATTCCAAATGCATCTTCATACTTT. Deletion right flank: GTACTTGTTGTAGCAGATTCAGTCATATAT. Insertion Sequence: CAATCATCCATTGTCAATGTTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2262 C. elegans acr-10(ok3064) X. Show Description
R02E12.8. Homozygous. Outer Left Sequence: GACATTTGACGGTTCCGTTT. Outer Right Sequence: GCGAAATTGTGCATTTCTTG. Inner Left Sequence: CGATCCGTAACTTGGAAACAA. Inner Right Sequence: GAATTAGGAGCACACGACCA. Inner Primer PCR Length: 1151 bp. Deletion Size: 386 bp. Deletion left flank: TACTCAAGAAGATGCATAGGTTAGTCCAGC. Deletion right flank: CGCAATGGCTTTAGACAGATTATGCTTACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807