Y73B3B.2 Homozygous. Outer Left Sequence: tgaaaacgtgctcgtacacc. Outer Right Sequence: atgactacggtagatggcgg. Inner Left Sequence: tcgtgcaaagtttgagcatt. Inner Right Sequence: ggaccgaaacatttttgcat. Inner Primer PCR Length: 1130. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46G5A.35 Homozygous. Outer Left Sequence: cttcaggaatcggtttcagc. Outer Right Sequence: agaagccgaagagaaaagcc. Inner Left Sequence: taatctcctcctcagccgtc. Inner Right Sequence: cacatgaagcgtcttcggta. Inner Primer PCR Length: 1314. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F12F6.5. Homozygous. Outer Left Sequence: GATGTGAAGGCTGACAAGCA. Outer Right Sequence: TAACCCGTGCATTTGTTGAA. Inner Left Sequence: CTTCGAGGCCAATCATCAAT. Inner Right Sequence: GCCAAAACTATCATGGGCTG. Inner Primer PCR Length: 2904 bp. Deletion Size: 1406 bp. Deletion left flank: ttttattactttgttttatatttcaaaaac. Deletion right flank: atcaagtcgatcttcaaatcgatcaaaagc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07D3.7. Homozygous. Outer Left Sequence: tctgagtttggctcgatgtg. Outer Right Sequence: atgttccttggataccagcg. Inner Left Sequence: agcccagaactgggaaactt. Inner Right Sequence: aagtcgaattccgttggatg. Inner primer WT PCR product: 3297. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16H11.3. Homozygous. Outer Left Sequence: atcggcaaaggattcatcag. Outer Right Sequence: ttcttgtctggctgcctttt. Inner Left Sequence: tccattgtggctatgagctg. Inner Right Sequence: gatcgaacacctatgccgtt. Inner primer WT PCR product: 3216. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C53D5.5. Homozygous. Outer Left Sequence: ccagcttctagccgcataac. Outer Right Sequence: caggtctcgaaacgaccaat. Inner Left Sequence: cccgtttttcagctttgtgt. Inner Right Sequence: acgggcaatattttcggaat. Inner primer WT PCR product: 2904. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R04A9.4. Homozygous. Outer Left Sequence: AAACATTCGTTCATTTCCGC. Outer Right Sequence: GCACAGCAGCGATGTAAAAA. Inner Left Sequence: ATTTAAGTGGCTGGTGTGGC. Inner Right Sequence: CGTTTTGCCAATCGAATTTT. Inner primer WT PCR product: 2315. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C03G6.19. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC317.3. Homozygous. Outer Left Sequence: TCAAAATACAGGGGTAGGCG. Outer Right Sequence: ACAATTCCTGGAACTCACGG. Inner Left Sequence: TGAAGAGGTTTTGAAACGCA. Inner Right Sequence: ACTTTCCGAGAGGAATGGGT. Inner Primer PCR Length: 2747 bp. Deletion Size: 1258 bp. Deletion left flank: GCGATTTTTGTGCTTGGCGTCAAAAATGAT. Deletion right flank: AAATGCATCGGACATGACAAAACCATCGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55C7.7d. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01D7.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01D7.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1307.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

EEED8.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54E4.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01B7.6 Homozygous. Outer Left Sequence: cgaatctcctccacggaata. Outer Right Sequence: atcgatttgatggtacggga. Inner Left Sequence: tggaatggattctggtggat. Inner Right Sequence: gagttgggctgtatggagga. Inner Length: 2972. Estimated Deletion Size: 2272. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C05E4.1. Homozygous. Outer Left Sequence: CTTACTGCCGCAAATCTTCGCGA . Outer Right Sequence: GTTGCGTAGAACTTTCGAGCCTA. Inner Left Sequence: CACTTTATGACGGCACAAAAAAG. Inner Right Sequence: GTGTTATTCTAATTGTCTCGGAAC. Inner primer WT PCR product: 2719. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C43F9.6. Homozygous. Outer Left Sequence: cggtgctgcattgtgtctat. Outer Right Sequence: tcgtactgcttgtttgcgtc. Inner Left Sequence: aaatcgttcgaaattgtggg. Inner Right Sequence: tctcgacagacggtgagttg. Inner primer WT PCR product: 2548. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F07G6.2. Homozygous. Outer Left Sequence: tgcgctgtttagaattgtgc. Outer Right Sequence: ctcattgggcaaagtctggt. Inner Left Sequence: tgcgcagtgttccaataaag. Inner Right Sequence: atccgaaccattgactgagg. Inner primer WT PCR product: 2748. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35G12.3A. Homozygous. Outer Left Sequence: CACTGAGCAATTGCCTTTCA. Outer Right Sequence: ATCGCCGAAGGTAGGTTTTT. Inner Left Sequence: CAAACACATCATCCACCACC. Inner Right Sequence: TTTCTTCCAGGTGGATTTGC. Inner primer WT PCR product: 3269. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F38A6.2. Homozygous. Outer Left Sequence: CTTGTCTCGTCCCTGAAAGC. Outer Right Sequence: GCTCGCTTTCCTATTCAACG. Inner Left Sequence: TTGCCAATTCCAAACAGACA. Inner Right Sequence: ATTATATCCGACGTGCTGCC. Inner primer WT PCR product: 3036. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44G3.6. Homozygous. Outer Left Sequence: tgtaccaccgtgaggaaaca. Outer Right Sequence: atgcacacattacccccatt. Inner Left Sequence: gcgactcattcagcatcaga. Inner Right Sequence: tggcataggtcctggcttag. Inner primer WT PCR product: 2405. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57F10.1. Homozygous. Anion exchange protein. Outer Left Sequence: attgtgattgcaccaagcag. Outer Right Sequence: aatcaatgagacgcggaatc. Inner Left Sequence: tggtgatggcacaaagtgtt. Inner Right Sequence: tcgatgaatggatacggtga. Inner primer WT PCR product: 2831. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08F4.8. Homozygous. Outer Left Sequence: atgctgggtgaaactaacgg. Outer Right Sequence: caaaagcatcgcagaaaaca. Inner Left Sequence: ctggaagttgtccagatggc. Inner Right Sequence: tccggtgtgaaatgtaacga. Inner primer WT PCR product: 2582. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK337.5. Homozygous. Outer Left Sequence: ACTGAAATGGGTGCTGCTCT. Outer Right Sequence: CAAATGTTGAGTCTTGCCGA. Inner Left Sequence: TGATAGTTCCGCCAACAACA. Inner Right Sequence: ACGCAGCCTTCTCAACTGAT. Inner primer WT PCR product: 2985. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK637.11. Homozygous. Strain grows better at 15 degrees. Outer Left Sequence: GTTCCTTCTCTAATCCCCGC . Outer Right Sequence: GTTTTTGATTCGCAGGTGGT. Inner Left Sequence: GTTTTCTGTCCACTTCCCGA. Inner Right Sequence: CCCACAATGAGACGAGTGTG . Inner primer WT PCR product: 2592. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK829.10. Homozygous. Outer Left Sequence: CACGTGTAAGCTCGACTCCA. Outer Right Sequence: ACATTGAACAATGCGGAACA. Inner Left Sequence: GGCCCACTCTTTAATACGCA. Inner Right Sequence: GAACTTGCCCCCACATCTAA. Inner primer WT PCR product: 3546. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0273.2. Homozygous. Outer Left Sequence: cagattttgagccaagctcc. Outer Right Sequence: gtgaacttctcgaagacggc. Inner Left Sequence: aatcattttcccgtccgttt. Inner Right Sequence: tccagtggatagttggcct. Inner primer WT PCR product: 3185. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15A8.5. [NOTE (10/28/11): Possible heterozygous strain; genotype being confirmed by Moerman Lab] Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C46G7.2. Homozygous. Outer Left Sequence: tgaagtgccctgctatcaca. Outer Right Sequence: aatcaatgctctcgctcgtt. Inner Left Sequence: tccagttccctaggcacatc. Inner Right Sequence: gatgggtcttgcaacgattt. Inner primer WT PCR product: 2450. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02D1.5. Homozygous. ABC transporter. Outer Left Sequence: aaacagcctgagacggaatg. Outer Right Sequence: tatgtattggtgcggcttga. Inner Left Sequence: atgccatgacacttgcttca. Inner Right Sequence: atgcaccacctgtgcaaata. Inner primer WT PCR product: 2613. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T06H11.4. Received new stock 9/15/04. Homozygous. [NOTE: Seems to grow better at lower temperature (15C).] Outer Left Sequence: GGTCTGTTGCATGTGGTTTG. Outer Right Sequence: TTCGTCATCCCTCTTCATCC. Inner Left Sequence: TCTAAGCTGCAAACTCGCAA. Inner Right Sequence: AATCTGTTACCCTTGCTGCG. Inner primer WT PCR product: 3273. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39A1A.19. Homozygous. Outer Left Sequence: GACCTTTTTCGAATTTGCCA. Outer Right Sequence: ACCGAGTTCATGGAGGTACG. Inner Left Sequence: TGTCGAGGTGACTTGCTTTG. Inner Right Sequence: TTGGCAATTACGTTGTGGAA. Inner primer WT PCR product: 3172. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57B10.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B12.8 Homozygous. Outer Left Sequence: CGAGAACCTGCTTTTCAAGG. Outer Right Sequence: CAATCTTGTGCTACTGCCGA. Inner Left Sequence: ATTTGCTGCGAACCTTGACT. Inner Right Sequence: GCCGCGAATCATTGTATTTC. Inner Primer PCR Length: 2690. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Heterozygotes are wild type and segregate wild type, Dpy Uncs, and arrested early larva (L1s). Pick WT to maintain.

Superficially wild-type. Derived by outcrossing RB820 eight times to N2. Reference: Maia, A.F. et al. 2015 Sci Data 2:150020.

heEx526 [myo-2p::GFP]. Superficially wild-type. Pick GFP+ to maintain. Derived by crossing SV1005 and SV1069. Reference: Maia, A.F. et al. 2015 Sci Data 2:150020.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

Y54G9A.6. IR sensitive. To genotype: External left primer: GTCCCGTTTCCCCCATTTG. External right primer: CTCTTCATCATCTCCTCTCC. Internal right primer: CTCCTCCGAACGCTACTT. External WT amplicon: 1970 bp. External mutant amplicon: 1635 bp. Internal WT amplicon: 1534 bp. Reference: Bertolini S, et al. G3 (Bethesda). 2017 Dec 4;7(12):3875-3885. Kim T, et al. J Cell Biol. 2015 May 25;209(4):507-17.

T03F6.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26E4.10. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok369 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGTCTCGAAGTTCTTGCCT. External right primer: AAACGAAGAACGAGCTGGAA. Internal left primer: TCAGGAACCATCGTGTGAAA. Internal right primer: CTTGCATGCCATCATATTCG. Internal WT amplicon: 2395 bp. Deletion size: 1742 bp. Deletion left flank: CTAGATTAGCCAAAGCCAGCTCAGCCACCC. Deletion right flank: TATCGTTGAATTTATATTCGATGACTTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15B9.1, F15B9.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok313 homozygotes (mid- to late larval arrest, may develop to adulthood and lay eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807