More Fields
Strain Species Genotype
RB2425 C. elegans K08E4.2(ok3331) IV. Show Description
K08E4.2 Homozygous. Outer Left Sequence: aactccaatgaaaccgcaac. Outer Right Sequence: ttttctctgtgccctccagt. Inner Left Sequence: ctgcaaaatgcatagcgaaa. Inner Right Sequence: tgtttgttctgatacatggcaa. Inner Primer PCR Length: 1164. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2426 C. elegans K09C8.2(ok3332) X. Show Description
K09C8.2 Homozygous. Outer Left Sequence: acacgaggcccactgtaatc. Outer Right Sequence: cgttcaaacacaaccacctg. Inner Left Sequence: cgtaaggaacgagggatcaa. Inner Right Sequence: cggtctccctatcttcacca. Inner Primer PCR Length: 1171. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2427 C. elegans F13H8.11(ok3333) II. Show Description
F13H8.11 Homozygous. Outer Left Sequence: aaccaggagagcttgcaaaa. Outer Right Sequence: cttcttgaaaatggcacggt. Inner Left Sequence: ctgaaggaactcggagaaatc. Inner Right Sequence: gcgtttatggattcaatggg. Inner Primer PCR Length: 1272. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2428 C. elegans T02C1.1(ok3334) III. Show Description
T02C1.1 Homozygous. Outer Left Sequence: tgttcttctttccctcccct. Outer Right Sequence: tcgagaatcattcaacgcaa. Inner Left Sequence: cctttcgttcttaccttccg. Inner Right Sequence: ggtaaacaaaaagtggacaatgg. Inner Primer PCR Length: 1166. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2429 C. elegans sao-1(ok3335) V. Show Description
R10D12.14 Homozygous. Outer Left Sequence: aagagcgagatgacgaggaa. Outer Right Sequence: accatttgtccgagcaactc. Inner Left Sequence: gacatcaaaataccgacggc. Inner Right Sequence: gaacacgagaagcctgttcc. Inner Primer PCR Length: 1196. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2430 C. elegans tig-2(ok3336) V. Show Description
F39G3.8 Homozygous. Outer Left Sequence: gagttgtggaggcggatcta. Outer Right Sequence: agtgtttccagacaggccac. Inner Left Sequence: tcagagctttagcggcaaat. Inner Right Sequence: aacaaatccgcgagctctt. Inner Primer PCR Length: 1207. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2431 C. elegans T23G11.7(ok3337) I. Show Description
T23G11.7 Homozygous. Outer Left Sequence: aatgtctgcgaatctcccac. Outer Right Sequence: aaaagcatacggacactggg. Inner Left Sequence: atctcattttccccgctttt. Inner Right Sequence: aaaaggattgatggaataaatcaga. Inner Primer PCR Length: 1184. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2432 C. elegans nas-21(ok3342) V. Show Description
T11F9.5 Homozygous. Outer Left Sequence: ccactttgcataatctcgca. Outer Right Sequence: catatagcccgcatccaaat. Inner Left Sequence: tccaatcagagctacgagca. Inner Right Sequence: tgattctacaatgacagctggttt. Inner Primer PCR Length: 1244. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2433 C. elegans ZK353.8(ok3343) III. Show Description
ZK353.8 Homozygous. Outer Left Sequence: tggcccatcgtttttcttag. Outer Right Sequence: agatggccagattttcgatg. Inner Left Sequence: tcgagtcttgttgttttccg. Inner Right Sequence: ggcaacatatcgattcgtca. Inner Primer PCR Length: 1251. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2434 C. elegans asg-2(ok3344) X. Show Description
C53B7.4 Homozygous. Outer Left Sequence: tccagaccggaggatacaag. Outer Right Sequence: atggcaaacttttgggtgac. Inner Left Sequence: tttgagcattagagtgagtttttg. Inner Right Sequence: ccagtaggcatagtggggtg. Inner Primer PCR Length: 1276. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2435 C. elegans C24G6.3(ok3345) V. Show Description
C24G6.3 Homozygous. Outer Left Sequence: aaaattggattttggagggg. Outer Right Sequence: gccattattgccgattttct. Inner Left Sequence: tctttgacggtttttctgaatg. Inner Right Sequence: tttgaaaagttaaaaacatacagatgc. Inner Primer PCR Length: 1193. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2436 C. elegans F59A7.9(ok3359) V. Show Description
F59A7.9 Homozygous. Outer Left Sequence: cctacacctgcctacttgcc. Outer Right Sequence: ccctacagtactccggcaga. Inner Left Sequence: ctaccaaagacgccttaccg. Inner Right Sequence: ttctccaatcaactacctccaa. Inner Primer PCR Length: 1194. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2437 C. elegans T13B5.8(ok3360) II. Show Description
T13B5.8 Homozygous. Outer Left Sequence: tgcaaatcagctctaatgcg. Outer Right Sequence: ggtggccgagtctaaagtca. Inner Left Sequence: aagtgtttcaagtgcgctcc. Inner Right Sequence: ccagttttccgtcgattttc. Inner Primer PCR Length: 1164. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2438 C. elegans ZK270.2(ok3361) I. Show Description
ZK270.2 Homozygous. Outer Left Sequence: catatgcaaaggtgtccacg. Outer Right Sequence: tcttcagcaaggcatctcct. Inner Left Sequence: gaagtgatgtattcctgtttcgt. Inner Right Sequence: agccttcagagaaatcgtcg. Inner Primer PCR Length: 1225. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2439 C. elegans F13D2.2(ok3362) X. Show Description
F13D2.2 Homozygous. Outer Left Sequence: aagcgggattcgaaggtatt. Outer Right Sequence: tcaaaacgttgcttgcattc. Inner Left Sequence: tgtcacagatagggaccgaa. Inner Right Sequence: ctagttgacggtagcaacgc. Inner Primer PCR Length: 1136. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2440 C. elegans C01B12.3(ok3363) II. Show Description
C01B12.3 Homozygous. Outer Left Sequence: aaccatttccctcatttcca. Outer Right Sequence: tcatcatcctctcccaaagg. Inner Left Sequence: tcactcgatgttgcttcttctt. Inner Right Sequence: gagaagcacttcggcaactt. Inner Primer PCR Length: 1105. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2441 C. elegans uba-5(ok3364) I. Show Description
T03F1.1 Homozygous. Outer Left Sequence: tttaaaccgccttggaaatg. Outer Right Sequence: agtgtgatggaaggcgagag. Inner Left Sequence: gaaagaccaccctctggagtc. Inner Right Sequence: gctccgactcatttaccagc. Inner Primer PCR Length: 1112. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2442 C. elegans C08E3.13(ok3365) II. Show Description
C08E3.13 Homozygous. Outer Left Sequence: gtcgaaaagttgccgaagtt. Outer Right Sequence: tcttcaaattaccaaggccg. Inner Left Sequence: acagccctggtgcagaacta. Inner Right Sequence: ggaaatgcgaatcccaacta. Inner Primer PCR Length: 1267. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2443 C. elegans abf-3(ok3366) V. Show Description
F54B8.5 Homozygous. Outer Left Sequence: tgcgaaacattccacagaaa. Outer Right Sequence: agatggcagacacgaagaca. Inner Left Sequence: agtttccagaagtcatgccc. Inner Right Sequence: cacagagtacgcttgcaaaa. Inner Primer PCR Length: 1126. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2444 C. elegans Y47G6A.3(ok3367) I. Show Description
Y47G6A.3 Homozygous. Outer Left Sequence: tggtcaagaacgtgctgaag. Outer Right Sequence: cagatcggcaattcggtaat. Inner Left Sequence: atcaaaccgtaacgggacag. Inner Right Sequence: tcagcagttatccaactccaaa. Inner Primer PCR Length: 1196. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2445 C. elegans tmd-2(ok3368) V. Show Description
C08D8.2Homozygous. Outer Left Sequence: ttacagaggcaatgcacgag. Outer Right Sequence: aaccggggatatcatcacaa. Inner Left Sequence: ccgaattgtttcttgggatg. Inner Right Sequence: tacaatccgttgcgtcaaaa. Inner Primer PCR Length: 1182. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2446 C. elegans C49C8.5(ok3369) IV. Show Description
C49C8.5 Homozygous. Outer Left Sequence: ttttgtgcctacccgtatcc. Outer Right Sequence: tatggccaattttcagaccc. Inner Left Sequence: gccgttgtcatcatcgtaaa. Inner Right Sequence: ttttgttactgttccagggctt. Inner Primer PCR Length: 1200. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2447 C. elegans str-220(ok3374) IV. Show Description
C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence:ccagactgtccaaaatccaga . Inner Primer PCR Length: 1146. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2448 C. elegans ZC84.3(ok3375) III. Show Description
ZC84.3 Homozygous. Outer Left Sequence: cttgggaaaccttgtcgtgt. Outer Right Sequence: caaacatttccctttttggc. Inner Left Sequence: caaagaaagacccgtttcca. Inner Right Sequence: tgcaaatatgttccaatcaataca. Inner Primer PCR Length: 1312. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2449 C. elegans Y58A7A.3(ok3376) V. Show Description
Y58A7A.3 Homozygous. Outer Left Sequence: gagtttgcccaagttgcatt. Outer Right Sequence: tttggaagttcggcataagg. Inner Left Sequence: ccggccatagaatttttcag. Inner Right Sequence: tggatcgaatcgaagcatct. Inner Primer PCR Length: 1240. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2450 C. elegans T24C12.3(ok3377) X. Show Description
T24C12.3 Homozygous. Outer Left Sequence: cttatgccataccccctcaa. Outer Right Sequence: cgcaaagtgcttgatttgaa. Inner Left Sequence: tatcgcatcagaaattgcca. Inner Right Sequence: gctattggcgatgacaacaa. Inner Primer PCR Length: 1135. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2451 C. elegans C34D1.1(ok3378) V. Show Description
C34D1.1 Homozygous. Outer Left Sequence: ctgtctgctgagcattgagc. Outer Right Sequence: gagacatgcacactagccga. Inner Left Sequence: gtctggcttgtcaccactga. Inner Right Sequence: gagagaagcaaaagggggag. Inner Primer PCR Length: 1136. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2452 C. elegans F11A3.1(ok3391) V. Show Description
F11A3.1 Homozygous. Outer Left Sequence: tgatccaaattgggactgct. Outer Right Sequence: ggattttgtggaaagcaagc. Inner Left Sequence: gaaagctctcttgtttcttcca. Inner Right Sequence: tttgtcaaactgtgccgatt. Inner Primer PCR Length: 1276. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2453 C. elegans cwp-2(ok3392) V. Show Description
C37H5.11 Homozygous. Outer Left Sequence: agattttgatgagcccgatg. Outer Right Sequence: acggagacgttttgtatggg. Inner Left Sequence: ctccgtttggctcatcagtt. Inner Right Sequence: atcctgccggattcattgta. Inner Primer PCR Length: 1127. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2454 C. elegans F08C6.6(ok3393) X. Show Description
F08C6.6 Homozygous. Outer Left Sequence: cacaaattggaaagcagcaa. Outer Right Sequence: aagcaaatgcaatttgggac. Inner Left Sequence: attctccgatcctactcgca. Inner Right Sequence: ttcttttcgggtttgtgacc. Inner Primer PCR Length: 1136. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2455 C. elegans F44D12.3(ok3394) IV. Show Description
F44D12.3 Homozygous. Outer Left Sequence: acaaataattctgcgggacg. Outer Right Sequence: acctcttccacgtcttctcg. Inner Left Sequence: tcttcaaaaactcgctgtgg. Inner Right Sequence: cacgaaaggtcactggttca. Inner Primer PCR Length: 1142. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2456 C. elegans grd-7(ok3395) X. Show Description
F46H5.6 Homozygous. Outer Left Sequence: tccgcgaaatctgataatcc. Outer Right Sequence: cctctcccccatcttttctc. Inner Left Sequence: ttatcctgaaggtcgttcgc. Inner Right Sequence: tgccgctgaagagtacaaaa. Inner Primer PCR Length: 1138. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2457 C. elegans F57B9.7(ok3396) III. Show Description
F57B9.7 Homozygous. Outer Left Sequence: ccggttctttgcattctcat. Outer Right Sequence: aatcgaaaattcgttgtcgg. Inner Left Sequence: gctcgtctaacgcgttttct. Inner Right Sequence: attagtaatgctcccccacg. Inner Primer PCR Length: 1227. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2458 C. elegans C10F3.1(ok3397) V. Show Description
C10F3.1 Homozygous. Outer Left Sequence: tgtcaagacgctcgatcaac. Outer Right Sequence: tgccaaatccctttcaagac. Inner Left Sequence: cgcgttgtgtaaactcgaaa. Inner Right Sequence: gctatgcagatcccccatatt. Inner Primer PCR Length: 1266. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2459 C. elegans F12A10.4(ok3398) II. Show Description
F12A10.4 Homozygous. Outer Left Sequence: tgtgcaatgggaaaaactga. Outer Right Sequence: attttggacgcgatagttgc. Inner Left Sequence: acgattgaggtaggcagtgg. Inner Right Sequence: tggaaggtttgcagacatga. Inner Primer PCR Length: 1278. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2460 C. elegans srx-95(ok3399) II. Show Description
F41G3.11 Homozygous. Outer Left Sequence: tgttttgccacgtcattgtt. Outer Right Sequence: aatatcagccacgccttcat. Inner Left Sequence: cattgcccttattcttccca. Inner Right Sequence: gcacaaaatcgttttgcttca. Inner Primer PCR Length: 1301. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2461 C. elegans nas-13(ok3400) X. Show Description
F39D8.4 Homozygous. Outer Left Sequence: ttttgggaagtggagcaatc. Outer Right Sequence: ttgtgtctgcctactgctgg. Inner Left Sequence: tgaatgcagttggagcgtag. Inner Right Sequence: ccttctccacccttcctctt. Inner Primer PCR Length: 1128. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2462 C. elegans oct-1(ok3401) I. Show Description
F52F12.1 Homozygous. Outer Left Sequence: catatgcctcgtcctggaac. Outer Right Sequence: ggccatgttcatcagaaggt. Inner Left Sequence: tttctttaccacgaagtaagcg. Inner Right Sequence: tctgaatgtttgaaagtcgca. Inner Primer PCR Length: 1353. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2463 C. elegans T25B6.2(ok3402) X. Show Description
T25B6.2 Homozygous. Outer Left Sequence: tgcatggatcttctcactgc. Outer Right Sequence: tctgggtacattgggctacc. Inner Left Sequence: gccatacggaactggatacg. Inner Right Sequence: aacctggttggttctgcatt. Inner Primer PCR Length: 1196. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2464 C. elegans tax-2(ok3403) I. Show Description
F36F2.5 Homozygous. Outer Left Sequence: cgccaagaagtgaagattcc. Outer Right Sequence: acgcttgtaatgccgaaagt. Inner Left Sequence: gcaaatgcttcaaaagagcc. Inner Right Sequence: gagtccgagcaattctgaaaa. Inner Primer PCR Length: 1121. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2465 C. elegans nas-16(ok3405) V. Show Description
K03B8.1 Homozygous. Outer Left Sequence: catatgtccagcgttccaaa. Outer Right Sequence: ggtcactttgtttttcccga. Inner Left Sequence: ggaacccgtcagaaaagaca. Inner Right Sequence: ttggatgggtccacttgatt. Inner Primer PCR Length: 1184. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2466 C. elegans F28D1.2(ok3406) IV. Show Description
F28D1.2 Homozygous. Outer Left Sequence: cctcttctccctcctcatca. Outer Right Sequence: tcatttcactcgcacaggtc. Inner Left Sequence: ttcaacctcgtagttctcctcc. Inner Right Sequence: cgactggttgtcaccctttt. Inner Primer PCR Length: 1189. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2467 C. elegans nas-38(ok3407) X. Show Description
F57C12.1 Homozygous. Outer Left Sequence: aaagccagaaccaaccactg. Outer Right Sequence: actcaatggcaaaagatgcc. Inner Left Sequence: caactacatatacaacggcaattc. Inner Right Sequence: ttaattcctttttccctgcatt. Inner Primer PCR Length: 1213. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2468 C. elegans ZK909.3(ok3408) I. Show Description
ZK909.3 Homozygous. Outer Left Sequence: gtttcctttccctttttggc. Outer Right Sequence: tagggcatgaaagcttggtt. Inner Left Sequence: cttctcctctgccagcattc. Inner Right Sequence: aatttatgcagggtcccca. Inner Primer PCR Length: 1252. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2469 C. elegans R08C7.12(ok3409) IV. Show Description
R08C7.12 Homozygous. Outer Left Sequence: aaacttccggcaaattgatg. Outer Right Sequence: aggcttaggcttaggcttgg. Inner Left Sequence: acggcagagttggcaattt. Inner Right Sequence: cagtcattctttgcgcttca. Inner Primer PCR Length: 1119. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2470 C. elegans pde-6(ok3410) I. Show Description
Y95B8A.10 Homozygous. Outer Left Sequence: actcctcaacaatccgatgc. Outer Right Sequence: tacaaaaacacggccacaaa. Inner Left Sequence: gctgacacaatccccactct. Inner Right Sequence: cttaaagatctcggccacca. Inner Primer PCR Length: 1161. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2471 C. elegans dsl-3(ok3411) IV. Show Description
Y41D4B.10 Homozygous. Outer Left Sequence: gcaaattcggcaaatctctt. Outer Right Sequence: atacccctttccaaaaaccg. Inner Left Sequence: ttgccgtgcttaacaaactc. Inner Right Sequence: atgaagtcacaggtgacaaaaa. Inner Primer PCR Length: 1353. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2472 C. elegans ZK970.1(ok3412) II. Show Description
ZK970.1 Homozygous. Outer Left Sequence: acgaatcgaatggaatctgc. Outer Right Sequence: attgttttgggcaggagttg. Inner Left Sequence: ttatgtgctggaaccgaaatc. Inner Right Sequence: gcaacttcctatccttctggc. Inner Primer PCR Length: 1112. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2473 C. elegans cpr-4(ok3413) V. Show Description
F44C4.3 Homozygous. Outer Left Sequence: agataacgagcactcccgaa. Outer Right Sequence: tcattgaagcaaaatgcgaa. Inner Left Sequence: aaaagaccatcgcaatgaag. Inner Right Sequence: ttcatgatcctatcagtccacg. Inner Primer PCR Length: 1247. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2474 C. elegans M28.2(ok3414) II. Show Description
M28.2 Homozygous. Outer Left Sequence: actgccctggttttggtaaa. Outer Right Sequence: atcttcaattcccggttgtg. Inner Left Sequence: tccttcacctcgattgcttt. Inner Right Sequence: ccaaagttttgtaattttcttccaa. Inner Primer PCR Length: 1146. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807