Y23B4A.2. Homozygous. Outer Left Sequence: TCGGCATTCTGTTAGGAAGC. Outer Right Sequence: ACGGAACAGATCTCCTCGAA. Inner Left Sequence: GACCGTAATCCCGTTCACAA. Inner Right Sequence: TGTATTTTGGTAACGCGTCG. Inner Primer PCR Length: 1292 bp. Deletion Size: 598 bp. Deletion left flank: TTCCTTTTCTGTCTTTTATTAATTTCCTTT. Deletion right flank: AAAATTTTGTTTTTCAGTAACAATTCCGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C12C8.2. Homozygous. Outer Left Sequence: GATGCGGAAATCCAACAACT. Outer Right Sequence: TCAAATGCAATCATTCCAGC. Inner Left Sequence: AATGAGATAGAAGGCGGTGC. Inner Right Sequence: GCATATTGATGCTGTGGGTG. Inner Primer PCR Length: 1191 bp. Deletion Size: 491 bp. Deletion left flank: GTTTTGGAGTTGAAATAACTTCTGTTGACG. Deletion right flank: AGTAAAAGACTTTAGTAAAAAGCTTCCAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45H7.4. Homozygous. Outer Left Sequence: ACGCACGAATCATGTTCAAA. Outer Right Sequence: ACCGAGCATACTGGCTTGTT. Inner Left Sequence: TCTTACCGTATTCGAAGAACTCG. Inner Right Sequence: CTGATTGTGGGTTTCAAGCA. Inner Primer PCR Length: 1347 bp. Deletion Size: 617 bp. Deletion left flank: GAGTTTTGTGGAGCCGGTGACCAAGTCGAT. Deletion right flank: ATGAGCCTTAAATTTAAGCACAAAAATATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R173.1. Homozygous. Outer Left Sequence: ATTTTGCGTCTTCCATTTGC. Outer Right Sequence: CAACTTATTTGCGTGGGCTT. Inner Left Sequence: GCCTCCCCATCAAACACTAC. Inner Right Sequence: TTTGATTCCAAAACACAGGG. Inner Primer PCR Length: 1243 bp. Deletion Size: 320 bp. Deletion left flank: TAACATTGAAGATTACTGTCTATTCCTTCT. Deletion right flank: TCGCGAAGGTTTAACTCTAAAAGAAGCACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R09A1.5. Homozygous. Outer Left Sequence: CCGTAATCGTTCCGCATTAT. Outer Right Sequence: GCCGAAATGGGACACTCTAA. Inner Left Sequence: CCAGGGAGTCTCTGTTCAGC. Inner Right Sequence: CTGTAGCAATAGTTTCAGCTGTG. Inner Primer PCR Length: 1333 bp. Deletion Size: 610 bp. Deletion left flank: CGGGCTATAGGCCTAGGCCAGGCTATAGGT. Deletion right flank: GTTCCTCGATGCACCATATCTTACGCGCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07D10.4. Homozygous. Outer Left Sequence: AAATGTGTTACGGTGTGCGA. Outer Right Sequence: TCGCATTCGCATAGTTTCAG. Inner Left Sequence: CTCACATTTGACTTTCGGCA. Inner Right Sequence: CTTCTCCATGCTTTTGCCAT. Inner Primer PCR Length: 1205 bp. Deletion Size: 760 bp. Deletion left flank: TAATTGTTGCATATTCCATACATCCATTAT. Deletion right flank: TTAATGAATCTGTGCTATCTGATATAACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6H.14. Homozygous. Outer Left Sequence: CAGCATCCGAGTCTGACAAA. Outer Right Sequence: GACCGTCTTCGTCCATCATT. Inner Left Sequence: TTCAGCATACTCTTCTTCATTCAC. Inner Right Sequence: GCGGACCGTTGACTTTCTAT. Inner Primer PCR Length: 1296 bp. Deletion Size: 333 bp. Deletion left flank: TCAACAACGTATCCACTGCTGGCGCGTGTC. Deletion right flank: TAAAAACTGTAAAACCATGTGAATTAATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49C5.4. Homozygous. Outer Left Sequence: ATGCCCCGACCCTATAAACT. Outer Right Sequence: AGTCCCCTAGGTGGCTTGAT. Inner Left Sequence: GGTTTTGCACGGTTAAGAGC. Inner Right Sequence: TCATCAATCGCCTTCTTTTC. Inner Primer PCR Length: 1154 bp. Deletion Size: 661 bp. Deletion left flank: CACAAGTTATGAAAAATTCCAGAAAAAGTA. Deletion right flank: TTAATTTTCAGAGATACATCCTACGCCGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49D10.10. Homozygous. Outer Left Sequence: TTTGAAATCCACACTTGGCA. Outer Right Sequence: TTTTGGCGGGAGAGAATAAA. Inner Left Sequence: AGCTCCGCAAATGACAATTC. Inner Right Sequence: TTCTCCGTTTCAAGATTTAGCA. Inner Primer PCR Length: 1256 bp. Deletion Size: 248 bp. Deletion left flank: TCAGTAGGATAATCAGATGTGATCTGAAAA. Deletion right flank: GAGCAGGTTTAATTTCCACAAATGCATCTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y18D10A.12, Y18D10A.23. Homozygous. Outer Left Sequence: ACCACGACTGGGAAGTTCAG. Outer Right Sequence: GCCTAACATCTGCCTTCTCG. Inner Left Sequence: ACTGGATTCTAGGCCCACG. Inner Right Sequence: GTTGCTCCATGCTACGTGAA. Inner Primer PCR Length: 1318 bp. Deletion Size: 719 bp. Deletion left flank: TTCTTCCGCCAACCCATACCTCGGCTGTTC. Deletion right flank: AATGCTCCGCAACAATGCAACGATCCACCC. Insertion Sequence: GCTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15D4.8. Homozygous. Outer Left Sequence: TTTTCGAAGCCTGTTAGCGT. Outer Right Sequence: TTTAAGTTTCCACAGGCGCT. Inner Left Sequence: AAAGTCCTGAAAAAGAAGCAGC. Inner Right Sequence: TTGAAAACAACGGTCTCGAA. Inner Primer PCR Length: 1201 bp. Deletion Size: 548 bp. Deletion left flank: CCTAAATTTGATGAATGAGTGTGGATCCGA. Deletion right flank: CCTATAGGCATCATCCATCAAAACCCCACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03B8.5. Homozygous. Outer Left Sequence: TACGTCATGTCGAGACTGGG. Outer Right Sequence: GAAAAATTCCCCACCGATTT. Inner Left Sequence: TGCTCAAGAATGAAAGCACG. Inner Right Sequence: TATTCCCCTCGATTTTTCGT. Inner Primer PCR Length: 1212 bp. Deletion Size: 785 bp. Deletion left flank: AGCCATTAATTCGTATGAATCTTGTTGTCT. Deletion right flank: GCGTAGGAAAAGAGTAGAATAATAGCTCCA. Insertion Sequence: ATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16D3.7. Homozygous. Outer Left Sequence: GGATAAGTACGGGCAACGAA. Outer Right Sequence: AATGCGGAACGTTTGAACTC. Inner Left Sequence: TGGAGAACAATTACCCCCTG. Inner Right Sequence: AGATGATGGGATTGAGCATTG. Inner Primer PCR Length: 1119 bp. Deletion Size: 410 bp. Deletion left flank: ATTGTCACGAAAACAAAAGTAATATCAGTG. Deletion right flank: GAAAGACAAACGGGATGGTGGAGCATCAGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22C8.2. Homozygous. Outer Left Sequence: TCCATTGCATTTTGGAAACA. Outer Right Sequence: AGAGGAAAAAGAGGCGAAGG. Inner Left Sequence: TATCCCCATTTTGCATTTGG. Inner Right Sequence: GCCTGCACCATTTTCAGATT. Inner Primer PCR Length: 1114 bp. Deletion Size: 377 bp. Deletion left flank: AATCTTGATAATGCAATATACAGGACGTCA. Deletion right flank: GCTGCTCTTAAATGCCGAGAAAACTTATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C32E12.2. Homozygous. Outer Left Sequence: GTGGCTTCAACTGGAGAAGG. Outer Right Sequence: CTATGTTCCTGCCGGTTGAT. Inner Left Sequence: TCGGAGTTGTTCAAATGGTG. Inner Right Sequence: CAAATGTGTTGTTATCCAAAATGA. Inner Primer PCR Length: 1115 bp. Deletion Size: 410 bp. Deletion left flank: GAGTTGCATTGGAAGTATTGGCATATCATA. Deletion right flank: CCAAATTGGAGGTTAGATTTCCAGATTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27F2.1. Homozygous. Outer Left Sequence: ACGAGATCCTTGGTTTGGTG. Outer Right Sequence: TATCATCGTCCATTGCTCCA. Inner Left Sequence: GGACCAGTTTTCGACCAAGA. Inner Right Sequence: TCGAAGAAGGAACTGAAACCT. Inner Primer PCR Length: 1179 bp. Deletion Size: 716 bp. Deletion left flank: CCACCGCCGTACGGAAAACGGACCAGTTTT. Deletion right flank: TCTCCAACAGACTCATATTAATGAAAACTT. Insertion Sequence: TCGACCAAGAGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T04H1.6. Homozygous. Outer Left Sequence: TGGAGGCTACGTTCCAAATC. Outer Right Sequence: TGAGAAGAAGGGAGGCAGAA. Inner Left Sequence: CTGTTCAGCAGCCATATCCA. Inner Right Sequence: CCACACATGAAACACCTCCA. Inner Primer PCR Length: 1313 bp. Deletion Size: 432 bp. Deletion left flank: AAGCTATTTTTATTTGTATGCTATCAATAT. Deletion right flank: GCCTCAATCCTGTATCCATGTGAGCAAACG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6E.4 Homozygous. Outer Left Sequence: cacctcggaaggctagaatg. Outer Right Sequence: ccgatccctgacgatatcaa. Inner Left Sequence: tcacaaaaccatttgaggaatg. Inner Right Sequence: ggcaaaacatttccatgtgc. Inner Primer PCR Length: 1244. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58B3.1. Homozygous. Outer Left Sequence: TGTTCACAATTGCGGTTTGT. Outer Right Sequence: GGGGCCCTTATGATCACTTT. Inner Left Sequence: CGCAAGAAGTTGCATGTTGA. Inner Right Sequence: TGGAATAATCAGATCATAAGGATGA. Inner Primer PCR Length: 1175 bp. Deletion Size: 601 bp. Deletion left flank: TATCTGCTTTTTGAAATGTAAAGCCATTTT. Deletion right flank: CTGGCCAAGCGAGACGTTCAATGTCAAGCC. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK829.6. Homozygous. [NOTE: it has been reported that ok3107 disrupts the native locus, this strain appears to also carry at least a partial duplication of the tgt-1 locus.] Outer Left Sequence: GACATCCTACCGTTTCCTGG. Outer Right Sequence: CTCCTTTGCAACACGTACCA. Inner Left Sequence: TACGGTAGGCCCGATAATGA. Inner Right Sequence: CTTGGACATCGTCCCGGT. Inner Primer PCR Length: 1172 bp. Deletion Size: 684 bp. Deletion left flank: AAAAAAATTGTGTTCGAACGTTATTTTTAT. Deletion right flank: GTTGTCAATACATGAATTACATGATCCAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M02D8.4. Homozygous. Outer Left Sequence: TGGATCTTGGTTCTTTTGCC. Outer Right Sequence: AAACCCATTGCGATTCAGAG. Inner Left Sequence: CTCAGATGGGAACTGCTCGT. Inner Right Sequence: GCATTTGTTCTTTGTTGCGA. Inner Primer PCR Length: 1250 bp. Deletion Size: 375 bp. Deletion left flank: TCCGTGTTGAAAGCTGATCGGAGAACAAAC. Deletion right flank: AGGTTCTTGATACCTTCCTTAAAACATATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09E8.2 Homozygous. Outer Left Sequence: tcttctggagcagggcttta. Outer Right Sequence: ccgttgcggaaatttttagt. Inner Left Sequence: tgaacaaagttatggtactttggaa. Inner Right Sequence: tgacaacttaccccgtttttc. Inner Primer PCR Length: 1219. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11G11.1. Homozygous. Outer Left Sequence: CGAATCATCATGAAAAGGCA. Outer Right Sequence: CATTTCCCACGCTTGAGTCT. Inner Left Sequence: GCGCAGTGGGAAGAGTAAAT. Inner Right Sequence: CCTTCTGCCGCAATTTTACA. Inner Primer PCR Length: 1208 bp. Deletion Size: 482 bp. Deletion left flank: TCAGATGTTTTTTTAGTTGTCATTGGCTTC. Deletion right flank: TGATCCAGCTCTTCTCGAAGAATTCCCACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 [NOTE: (06/03/2021) A user reported the original stock of RB2288 received by the CGC was heterozygous. A homozygous line was isolated and verified by PCR.]

Y47D3A.11. Homozygous. Outer Left Sequence: TTCCAGGTCAAAGAGCACCT. Outer Right Sequence: CCTTTGTAGCTGGCAAGTCC. Inner Left Sequence: CATCCAGGCTAAACTCCGTC. Inner Right Sequence: CAAAAGTACGCAGAAACCGA. Inner Primer PCR Length: 1206 bp. Deletion Size: 414 bp. Deletion left flank: GAGTTGTGGGTATCAGGTTCCGGATCATAC. Deletion right flank: TTTTCATTGGAACACTGTTTTACGGACTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54G2A.17. Homozygous. Outer Left Sequence: CCAAAATGGCTTGTGAGGAT. Outer Right Sequence: ATTCCAGAATCAATCGACGG. Inner Left Sequence: ATCTGACCGGCTTGTCAATG. Inner Right Sequence: ATGAACGGACAAGACTCGCT. Inner Primer PCR Length: 1165 bp. Deletion Size: 235 bp. Deletion left flank: AAAACGCAAGATAATCGCATTGTATACTCA. Deletion right flank: TGAATTCAAAGCAAAATCGCCCATAATTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

PDB1.1 Homozygous. Outer Left Sequence: tgtgttcgtttcagtctcgc. Outer Right Sequence: atgaaaaccaaaatgcgctc. Inner Left Sequence: acggaatatgctccctgatg. Inner Right Sequence: gcccacaaagaagatatgcaa. Inner Primer PCR Length: 1113. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y69A2AR.28 Homozygous. Outer Left Sequence: gtcgtcctccatcttgaacg. Outer Right Sequence: tgttgattgttctttgggca. Inner Left Sequence: gatcgtcgagtgctgcttg. Inner Right Sequence: tgagcgtttgaaccagaaag. Inner Primer PCR Length: 1124. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK632.9 Homozygous. Outer Left Sequence: cgaacatttcgtcatctcca. Outer Right Sequence: cgtctgctgttgattcgcta. Inner Left Sequence: ccaataaatcctagcggacg. Inner Right Sequence: aaagaaatctctacgccacaca. Inner Primer PCR Length: 1179. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK973.5 Homozygous. Outer Left Sequence: cagcgtgagtcatagccaaa. Outer Right Sequence: aattgagtttggcaaatcgg. Inner Left Sequence: cgttcccatctggtgagttc. Inner Right Sequence: ccgatttgccgaattgttta. Inner Primer PCR Length: 1131. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R09F10.1 Homozygous. Outer Left Sequence: agcgccaccgtatttaatga. Outer Right Sequence: gttcgggaaactgggatttt. Inner Left Sequence: ccgtgtaaggctgttgatga. Inner Right Sequence: gtatttgcaagaccgcagc. Inner Primer PCR Length: 1290. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C29F7.2 Homozygous. Outer Left Sequence: ctcgatagtgctggtgcaga. Outer Right Sequence: catcttttgaaggactcgcc. Inner Left Sequence: tgactgaaactgaccactctgc. Inner Right Sequence: aagaactggagaattggccc. Inner Primer PCR Length: 1242. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02B9.1 Homozygous. Outer Left Sequence: agagcatcggcttcagtgtt. Outer Right Sequence: aggatatcaccgacgtgagc. Inner Left Sequence: gggagcgtcacctaaaatga. Inner Right Sequence: ggaatgagaatcgggaatca. Inner Primer PCR Length: 1247. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y18D10A.12 Homozygous. Outer Left Sequence: accacgactgggaagttcag. Outer Right Sequence: gcctaacatctgccttctcg. Inner Left Sequence: actggattctaggcccacg. Inner Right Sequence: gttgctccatgctacgtgaa. Inner Primer PCR Length: 1317. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y18D10A.12 Homozygous. Outer Left Sequence: accacgactgggaagttcag. Outer Right Sequence: gcctaacatctgccttctcg. Inner Left Sequence: actggattctaggcccacg. Inner Right Sequence: gttgctccatgctacgtgaa. Inner Primer PCR Length: 1317. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32E10.2 Homozygous. Outer Left Sequence: caattaaaatgccagtgcga. Outer Right Sequence: aggtacactgcctggtggtc. Inner Left Sequence: tgtgcacgtctattcgattca. Inner Right Sequence: tttaggatgcattatggggc. Inner Primer PCR Length: 1127. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0412.2 Homozygous. Maintain at 15C. Outer Left Sequence: cttccttctttccctcccac. Outer Right Sequence: ttgtgacaatcggaagtgga. Inner Left Sequence: gcttatccggatttgacgaa. Inner Right Sequence: catttcttggcgatcattcc. Inner Primer PCR Length: 1162. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58A6.11 Homozygous. Outer Left Sequence: tgtggctggtctgggttaat. Outer Right Sequence: ttttgcaccactgctttgag. Inner Left Sequence: aagggagaagaaaacccgac. Inner Right Sequence: atgttcaatccgtgctgtca. Inner Primer PCR Length: 1200. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F31A9.3 Homozygous. Outer Left Sequence: acatctggttttagtgggcg. Outer Right Sequence: tacagagcatctcattgccg. Inner Left Sequence: ccattttcctgtgctccatc. Inner Right Sequence: attcccgtggataccgatct. Inner Primer PCR Length: 1120. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20D1.1 Homozygous. Outer Left Sequence: tgcacaactcggaaatgaaa. Outer Right Sequence: aatccaaagcttatcgcgtg. Inner Left Sequence: gcttaagtgagaggaggggg. Inner Right Sequence: gcaattctcaacggttttctc. Inner Primer PCR Length: 1207. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y105C5A.1 Homozygous. Outer Left Sequence: cgctttctcctgtaactgcc. Outer Right Sequence: cgtcctgctccaacacctat. Inner Left Sequence: cgtcgtcttcttatcctgcaa. Inner Right Sequence: atggaagagcaaaagccaaa. Inner Primer PCR Length: 1224. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D2023.6 Homozygous. Outer Left Sequence: tgtcaacggaggtgttttca. Outer Right Sequence: actatctgaacggcgaatgg. Inner Left Sequence: aacacatttcgggaatggaa. Inner Right Sequence: aaaaacggcagaaagaccaa. Inner Primer PCR Length: 1204. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C29F3.5 Homozygous. Outer Left Sequence: cgttcaactcaccagatcca. Outer Right Sequence: ttcgcgccaagtctaatttt. Inner Left Sequence: ctgcccagtcaaaatcacatt. Inner Right Sequence: aggagtgatggaccaattttt. Inner Primer PCR Length: 1298. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18D1.4 Homozygous. Outer Left Sequence: tgacacgtggaatgagtggt. Outer Right Sequence: agaaaccaattgtgcatccc. Inner Left Sequence: aaaaggagaaccggctgaat. Inner Right Sequence: ggttcttcaacaaatcattggc. Inner Primer PCR Length: 1313. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T16G12.1 Homozygous. Outer Left Sequence: caacccaacttttgccaact. Outer Right Sequence: tgcttatttggatgccatga. Inner Left Sequence: ctttttgggctcagacttcg. Inner Right Sequence: ggacaactctcgactttgatga. Inner Primer PCR Length: 1326. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R03G8.6 Homozygous. Outer Left Sequence: tgacatacgactcgacccaa. Outer Right Sequence: cggttttcaattgcgttttt. Inner Left Sequence: cggtccctagtaagctccaa. Inner Right Sequence: tgttgattttgcaaccgaaa. Inner Primer PCR Length: 1289. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40B5.1 Homozygous. Outer Left Sequence: taaatttcgagagccggatg. Outer Right Sequence: acgctttgtgcaagagtgtg. Inner Left Sequence: atggaggataacgcaaggaa. Inner Right Sequence: gaaagaggtgagcctggaga. Inner Primer PCR Length: 1192. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40B5.1 Homozygous. Outer Left Sequence: taaatttcgagagccggatg. Outer Right Sequence: acgctttgtgcaagagtgtg. Inner Left Sequence: atggaggataacgcaaggaa. Inner Right Sequence: gaaagaggtgagcctggaga. Inner Primer PCR Length: 1192. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y42H9AR.1 Homozygous. Outer Left Sequence: tcagtaaatcgcaggcagtg. Outer Right Sequence: gttggtgctgaagttgcaga. Inner Left Sequence: ttgtgccatctcaaaattgg. Inner Right Sequence: cgtaggatacgacggtggag. Inner Primer PCR Length: 1166. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27A8.1 Homozygous. Outer Left Sequence: atgctaatccggcacttcac. Outer Right Sequence: atctttattgcgttggtcgg. Inner Left Sequence: aaagaaggagaagtctcgacca. Inner Right Sequence: atgccccctaattttatgcc. Inner Primer PCR Length: 1177. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C50C10.7 Homozygous. Outer Left Sequence: tcgacctgtcaaacatcgaa. Outer Right Sequence: cgcatttgtgaacctgtttg. Inner Left Sequence: aaatcctcgtcgataacttttga . Inner Right Sequence: gcacacatatgggtctgcttt. Inner Primer PCR Length: 1212. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807